Incidental Mutation 'R0332:Optn'
ID35902
Institutional Source Beutler Lab
Gene Symbol Optn
Ensembl Gene ENSMUSG00000026672
Gene Nameoptineurin
SynonymsTFIIIA-INTP, 4930441O07Rik
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R0332 (G1)
Quality Score102
Status Validated
Chromosome2
Chromosomal Location5020642-5064051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5024115 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 526 (G526R)
Ref Sequence ENSEMBL: ENSMUSP00000110648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027986] [ENSMUST00000114996]
Predicted Effect probably damaging
Transcript: ENSMUST00000027986
AA Change: G526R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027986
Gene: ENSMUSG00000026672
AA Change: G526R

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
PDB:2ZVO|D 424 512 2e-11 PDB
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114996
AA Change: G526R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110648
Gene: ENSMUSG00000026672
AA Change: G526R

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
Pfam:CC2-LZ 407 510 3.2e-33 PFAM
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145501
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice hypomorphic allele exhibit background sensitive embryonic lethality with surviving mice exhibiting normal immune cell development, T and B cell activation and TNF- or LPS-mediated activation of cells of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Optn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Optn APN 2 5033156 missense possibly damaging 0.93
IGL01433:Optn APN 2 5027144 missense probably benign 0.07
IGL01480:Optn APN 2 5046018 missense probably benign 0.01
IGL01863:Optn APN 2 5021487 splice site probably benign
IGL02108:Optn APN 2 5031273 missense possibly damaging 0.91
IGL02150:Optn APN 2 5033152 missense probably damaging 0.97
IGL02623:Optn APN 2 5035022 missense probably damaging 1.00
R0119:Optn UTSW 2 5024115 missense probably damaging 1.00
R0121:Optn UTSW 2 5024115 missense probably damaging 1.00
R0330:Optn UTSW 2 5034255 missense possibly damaging 0.53
R0335:Optn UTSW 2 5024115 missense probably damaging 1.00
R0390:Optn UTSW 2 5046195 missense probably benign
R0437:Optn UTSW 2 5024115 missense probably damaging 1.00
R1710:Optn UTSW 2 5053130 missense possibly damaging 0.90
R2229:Optn UTSW 2 5024117 missense probably damaging 1.00
R3237:Optn UTSW 2 5034203 missense probably damaging 1.00
R3740:Optn UTSW 2 5034198 missense possibly damaging 0.51
R3741:Optn UTSW 2 5034198 missense possibly damaging 0.51
R4667:Optn UTSW 2 5033139 missense probably benign 0.20
R4783:Optn UTSW 2 5054627 missense probably benign
R4965:Optn UTSW 2 5021379 missense probably benign 0.14
R5121:Optn UTSW 2 5046106 missense probably benign 0.25
R6119:Optn UTSW 2 5021323 splice site probably null
Predicted Primers PCR Primer
(F):5'- CGATTCAGGTCAGCTAACAGACGC -3'
(R):5'- GGGTCAGTTTTCTTATGAAGGTCAGCC -3'

Sequencing Primer
(F):5'- TACTACCTGGCTGCGAGAG -3'
(R):5'- CATGTGGTTTTGACTTGTTTCCC -3'
Posted On2013-05-09