Incidental Mutation 'R4779:Tnnt3'
ID368156
Institutional Source Beutler Lab
Gene Symbol Tnnt3
Ensembl Gene ENSMUSG00000061723
Gene Nametroponin T3, skeletal, fast
SynonymsfTnT, skeletal muscle fast-twitch TnT
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4779 (G1)
Quality Score206
Status Validated
Chromosome7
Chromosomal Location142498836-142516009 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 142514283 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074187] [ENSMUST00000078497] [ENSMUST00000105941] [ENSMUST00000105942] [ENSMUST00000105943] [ENSMUST00000105944] [ENSMUST00000105945] [ENSMUST00000105946] [ENSMUST00000105947] [ENSMUST00000105948] [ENSMUST00000105949] [ENSMUST00000105950] [ENSMUST00000105952] [ENSMUST00000105953] [ENSMUST00000105954] [ENSMUST00000105955] [ENSMUST00000105957] [ENSMUST00000105958] [ENSMUST00000128294] [ENSMUST00000146804] [ENSMUST00000169299] [ENSMUST00000179658] [ENSMUST00000180152]
Predicted Effect probably benign
Transcript: ENSMUST00000074187
SMART Domains Protein: ENSMUSP00000073815
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 1.5e-42 PFAM
low complexity region 233 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078497
SMART Domains Protein: ENSMUSP00000077587
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 48 N/A INTRINSIC
Pfam:Troponin 72 214 2.1e-42 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105941
SMART Domains Protein: ENSMUSP00000101561
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 2.1e-42 PFAM
low complexity region 229 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105942
SMART Domains Protein: ENSMUSP00000101562
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:Troponin 43 185 1.7e-42 PFAM
low complexity region 224 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105943
SMART Domains Protein: ENSMUSP00000101563
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:Troponin 43 185 1.9e-42 PFAM
low complexity region 220 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105944
SMART Domains Protein: ENSMUSP00000101564
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:Troponin 54 196 2e-42 PFAM
low complexity region 235 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105945
SMART Domains Protein: ENSMUSP00000101565
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 1.5e-42 PFAM
low complexity region 233 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105946
SMART Domains Protein: ENSMUSP00000101566
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.8e-42 PFAM
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105947
SMART Domains Protein: ENSMUSP00000101567
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 63 205 1.9e-42 PFAM
low complexity region 240 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105948
SMART Domains Protein: ENSMUSP00000101568
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:Troponin 54 196 2.2e-42 PFAM
low complexity region 231 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105949
SMART Domains Protein: ENSMUSP00000101569
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:Troponin 48 190 1.8e-42 PFAM
low complexity region 229 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105950
SMART Domains Protein: ENSMUSP00000101570
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
Pfam:Troponin 66 208 1.9e-42 PFAM
internal_repeat_1 213 240 4.67e-5 PROSPERO
low complexity region 247 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105952
SMART Domains Protein: ENSMUSP00000101572
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 63 205 1.8e-42 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105953
SMART Domains Protein: ENSMUSP00000101573
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
Pfam:Troponin 66 208 1.9e-42 PFAM
low complexity region 247 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105954
SMART Domains Protein: ENSMUSP00000101574
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
Pfam:Troponin 67 209 1.9e-42 PFAM
low complexity region 248 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105955
SMART Domains Protein: ENSMUSP00000101575
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 36 N/A INTRINSIC
Pfam:Troponin 59 201 2.2e-42 PFAM
low complexity region 240 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105957
SMART Domains Protein: ENSMUSP00000101577
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
low complexity region 4 36 N/A INTRINSIC
Pfam:Troponin 63 205 1.8e-42 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105958
SMART Domains Protein: ENSMUSP00000101578
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 218 2.1e-42 PFAM
low complexity region 253 269 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125649
Predicted Effect probably benign
Transcript: ENSMUST00000128294
SMART Domains Protein: ENSMUSP00000116223
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Troponin 49 107 3.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144259
Predicted Effect probably benign
Transcript: ENSMUST00000146804
SMART Domains Protein: ENSMUSP00000116087
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Troponin 49 191 1.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153262
Predicted Effect probably benign
Transcript: ENSMUST00000169299
SMART Domains Protein: ENSMUSP00000127854
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.8e-42 PFAM
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179658
SMART Domains Protein: ENSMUSP00000136278
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 212 1.5e-36 PFAM
low complexity region 257 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180152
SMART Domains Protein: ENSMUSP00000137111
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 218 5.1e-42 PFAM
internal_repeat_1 223 250 2.76e-5 PROSPERO
low complexity region 257 269 N/A INTRINSIC
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased fetal weight, liver and kidney hemorrhage and thin diaphragm. Mice heterozygous for this allele exhibit growth retardation with mild skeleton defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Tnnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Tnnt3 APN 7 142508325 intron probably benign
IGL02376:Tnnt3 APN 7 142512558 missense possibly damaging 0.64
R0432:Tnnt3 UTSW 7 142512086 missense probably benign 0.09
R0463:Tnnt3 UTSW 7 142512335 missense probably benign 0.25
R1421:Tnnt3 UTSW 7 142511366 missense probably damaging 0.97
R1521:Tnnt3 UTSW 7 142515825 nonsense probably null
R1789:Tnnt3 UTSW 7 142512364 missense probably damaging 1.00
R1990:Tnnt3 UTSW 7 142511525 missense possibly damaging 0.78
R1991:Tnnt3 UTSW 7 142511525 missense possibly damaging 0.78
R2029:Tnnt3 UTSW 7 142512627 splice site probably benign
R2216:Tnnt3 UTSW 7 142512564 missense probably benign 0.03
R5568:Tnnt3 UTSW 7 142512040 missense probably damaging 0.98
R5756:Tnnt3 UTSW 7 142502758 critical splice donor site probably null
R5994:Tnnt3 UTSW 7 142511266 missense probably damaging 1.00
R6265:Tnnt3 UTSW 7 142501645 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCGTAGCCACAAGGTAAG -3'
(R):5'- ACATGCCTAGGTCCTACGTAG -3'

Sequencing Primer
(F):5'- CACAAGGTAAGTGGACAGCTG -3'
(R):5'- CTAGGTCCTACGTAGGGTTGCAG -3'
Posted On2015-12-29