Incidental Mutation 'R5016:Olfr1089'
ID385557
Institutional Source Beutler Lab
Gene Symbol Olfr1089
Ensembl Gene ENSMUSG00000111711
Gene Nameolfactory receptor 1089
SynonymsMOR193-1, GA_x6K02T2Q125-48226321-48225386
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86732584-86733701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86732746 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 289 (I289L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214317]
Predicted Effect probably benign
Transcript: ENSMUST00000099876
AA Change: I289L

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097461
Gene: ENSMUSG00000075173
AA Change: I289L

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 4.7e-47 PFAM
Pfam:7tm_1 41 290 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214317
AA Change: I289L

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
Meta Mutation Damage Score 0.346 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Olfr1089
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Olfr1089 APN 2 86733235 missense possibly damaging 0.90
IGL00944:Olfr1089 APN 2 86733561 missense possibly damaging 0.80
IGL01478:Olfr1089 APN 2 86733329 nonsense probably null
IGL01636:Olfr1089 APN 2 86733601 nonsense probably null
IGL01887:Olfr1089 APN 2 86732686 missense probably benign 0.03
IGL02008:Olfr1089 APN 2 86733177 missense possibly damaging 0.90
IGL02470:Olfr1089 APN 2 86733585 missense probably damaging 0.97
IGL02560:Olfr1089 APN 2 86733234 missense probably damaging 1.00
R1782:Olfr1089 UTSW 2 86732682 missense probably benign 0.03
R2234:Olfr1089 UTSW 2 86733577 missense possibly damaging 0.94
R2866:Olfr1089 UTSW 2 86733429 missense possibly damaging 0.95
R3027:Olfr1089 UTSW 2 86733586 missense possibly damaging 0.79
R4275:Olfr1089 UTSW 2 86733592 missense probably damaging 1.00
R4799:Olfr1089 UTSW 2 86732674 unclassified probably null
R5154:Olfr1089 UTSW 2 86732777 nonsense probably null
R5355:Olfr1089 UTSW 2 86733336 missense probably damaging 1.00
R5624:Olfr1089 UTSW 2 86732805 missense probably benign 0.45
R6265:Olfr1089 UTSW 2 86732955 missense probably damaging 0.99
X0028:Olfr1089 UTSW 2 86732748 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTCATGCCTGCTATATAAAGG -3'
(R):5'- ATGAACTCTACTGAGGGCAGGC -3'

Sequencing Primer
(F):5'- TCTAGTAGTCAGGGACACAGTGTATC -3'
(R):5'- CTCTACTGAGGGCAGGCACAAG -3'
Posted On2016-05-10