Incidental Mutation 'R5016:Wdr3'
ID385561
Institutional Source Beutler Lab
Gene Symbol Wdr3
Ensembl Gene ENSMUSG00000033285
Gene NameWD repeat domain 3
SynonymsD030020G18Rik
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location100138180-100162407 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 100141620 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052120] [ENSMUST00000164539]
Predicted Effect probably benign
Transcript: ENSMUST00000052120
SMART Domains Protein: ENSMUSP00000060613
Gene: ENSMUSG00000033285

DomainStartEndE-ValueType
Blast:WD40 12 51 3e-16 BLAST
WD40 54 93 3.14e-6 SMART
WD40 96 135 1.04e-6 SMART
WD40 138 177 1.15e-4 SMART
WD40 180 219 4.24e-3 SMART
low complexity region 225 239 N/A INTRINSIC
Blast:WD40 267 307 3e-18 BLAST
low complexity region 316 331 N/A INTRINSIC
WD40 403 441 8.49e-3 SMART
WD40 444 481 1.71e1 SMART
WD40 484 523 2.1e-7 SMART
WD40 538 576 1.2e-2 SMART
WD40 579 618 2.45e-8 SMART
WD40 621 660 5.47e-6 SMART
WD40 663 702 1.03e-10 SMART
low complexity region 711 724 N/A INTRINSIC
Pfam:Utp12 803 906 6.4e-25 PFAM
low complexity region 927 936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146989
SMART Domains Protein: ENSMUSP00000134945
Gene: ENSMUSG00000033285

DomainStartEndE-ValueType
Blast:WD40 12 51 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164539
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein containing 10 WD repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, which usually include a trp-asp at the C-terminal end. Proteins belonging to the WD repeat family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Wdr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Wdr3 APN 3 100148108 missense probably damaging 1.00
IGL00706:Wdr3 APN 3 100148100 unclassified probably benign
IGL01391:Wdr3 APN 3 100146789 unclassified probably benign
IGL02008:Wdr3 APN 3 100150982 missense probably damaging 0.97
IGL02136:Wdr3 APN 3 100138725 nonsense probably null
IGL02215:Wdr3 APN 3 100146700 critical splice donor site probably null
IGL02505:Wdr3 APN 3 100151974 missense probably benign
IGL03412:Wdr3 APN 3 100151977 missense probably benign 0.00
R0241:Wdr3 UTSW 3 100145657 missense probably damaging 1.00
R0241:Wdr3 UTSW 3 100145657 missense probably damaging 1.00
R0369:Wdr3 UTSW 3 100156418 nonsense probably null
R0865:Wdr3 UTSW 3 100152796 unclassified probably benign
R0966:Wdr3 UTSW 3 100161069 missense probably damaging 0.99
R1168:Wdr3 UTSW 3 100142219 missense probably benign 0.11
R1612:Wdr3 UTSW 3 100151199 splice site probably benign
R1768:Wdr3 UTSW 3 100153870 missense probably benign
R2060:Wdr3 UTSW 3 100159897 unclassified probably null
R3793:Wdr3 UTSW 3 100151965 missense probably benign 0.02
R3888:Wdr3 UTSW 3 100153906 missense probably benign
R4410:Wdr3 UTSW 3 100140227 missense probably benign
R4596:Wdr3 UTSW 3 100152867 missense possibly damaging 0.95
R4609:Wdr3 UTSW 3 100140200 missense probably damaging 1.00
R4817:Wdr3 UTSW 3 100146545 missense possibly damaging 0.71
R5024:Wdr3 UTSW 3 100154936 missense probably benign
R5411:Wdr3 UTSW 3 100142984 missense probably damaging 1.00
R5430:Wdr3 UTSW 3 100157327 missense possibly damaging 0.88
R5902:Wdr3 UTSW 3 100144491 unclassified probably benign
R6177:Wdr3 UTSW 3 100161152 missense probably damaging 0.97
R6445:Wdr3 UTSW 3 100156403 missense possibly damaging 0.65
R6516:Wdr3 UTSW 3 100145676 missense probably damaging 1.00
R6624:Wdr3 UTSW 3 100144326 missense probably damaging 1.00
R6747:Wdr3 UTSW 3 100138724 missense probably damaging 1.00
R6813:Wdr3 UTSW 3 100138725 nonsense probably null
R6899:Wdr3 UTSW 3 100149901 missense possibly damaging 0.90
R7024:Wdr3 UTSW 3 100154997 missense probably benign 0.00
X0012:Wdr3 UTSW 3 100145630 splice site probably null
Z1088:Wdr3 UTSW 3 100144344 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGCTTCTGAGAGCTGGTATTTG -3'
(R):5'- AGGCCCAGCTTACAAGGAAG -3'

Sequencing Primer
(F):5'- CTGAGAGCTGGTATTTGATTGACATC -3'
(R):5'- CCCAGCTTACAAGGAAGTGTAGTC -3'
Posted On2016-05-10