Incidental Mutation 'R5016:Vmn1r202'
ID385592
Institutional Source Beutler Lab
Gene Symbol Vmn1r202
Ensembl Gene ENSMUSG00000094379
Gene Namevomeronasal 1 receptor 202
SynonymsV1ri7
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22497750-22505381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22502205 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 14 (F14Y)
Ref Sequence ENSEMBL: ENSMUSP00000154314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078642] [ENSMUST00000228020]
Predicted Effect probably damaging
Transcript: ENSMUST00000078642
AA Change: F14Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077711
Gene: ENSMUSG00000094379
AA Change: F14Y

DomainStartEndE-ValueType
Pfam:TAS2R 5 301 2.2e-11 PFAM
Pfam:V1R 35 300 5.6e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228020
AA Change: F14Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0304 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc12a6 C T 2: 112,356,627 probably benign Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Vmn1r202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn1r202 APN 13 22501989 missense possibly damaging 0.95
IGL01516:Vmn1r202 APN 13 22501462 missense possibly damaging 0.57
IGL01722:Vmn1r202 APN 13 22501720 missense probably benign 0.00
IGL02641:Vmn1r202 APN 13 22502104 missense probably benign 0.34
IGL02863:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL02876:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL02891:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL02943:Vmn1r202 APN 13 22502194 missense probably benign 0.01
IGL03057:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03114:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03114:Vmn1r202 APN 13 22501330 utr 3 prime probably benign
IGL03143:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03159:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03097:Vmn1r202 UTSW 13 22501470 missense probably benign 0.00
R0611:Vmn1r202 UTSW 13 22501654 missense probably damaging 1.00
R1350:Vmn1r202 UTSW 13 22501716 missense probably benign 0.04
R1666:Vmn1r202 UTSW 13 22501370 missense possibly damaging 0.94
R1668:Vmn1r202 UTSW 13 22501370 missense possibly damaging 0.94
R1803:Vmn1r202 UTSW 13 22502143 missense probably benign 0.00
R2035:Vmn1r202 UTSW 13 22501602 missense probably damaging 0.98
R2112:Vmn1r202 UTSW 13 22501734 missense possibly damaging 0.76
R2145:Vmn1r202 UTSW 13 22501783 missense possibly damaging 0.79
R3026:Vmn1r202 UTSW 13 22501762 missense probably benign 0.03
R3808:Vmn1r202 UTSW 13 22501900 missense possibly damaging 0.83
R4714:Vmn1r202 UTSW 13 22501807 missense probably damaging 1.00
R5124:Vmn1r202 UTSW 13 22501750 missense probably benign 0.01
R6136:Vmn1r202 UTSW 13 22501462 missense possibly damaging 0.90
R6365:Vmn1r202 UTSW 13 22502204 missense probably benign 0.12
R6982:Vmn1r202 UTSW 13 22501747 missense probably benign 0.02
R7293:Vmn1r202 UTSW 13 22501702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATCATGGCTATGGTTCTGACTC -3'
(R):5'- ATCACCATCTCCAGGTCAGC -3'

Sequencing Primer
(F):5'- CATGGCTATGGTTCTGACTCCTATG -3'
(R):5'- ATCTCCAGGTCAGCGGAAC -3'
Posted On2016-05-10