Incidental Mutation 'R5016:Slc12a6'
ID385558
Institutional Source Beutler Lab
Gene Symbol Slc12a6
Ensembl Gene ENSMUSG00000027130
Gene Namesolute carrier family 12, member 6
Synonymsgaxp, KCC3
MMRRC Submission 042607-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R5016 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112265825-112363163 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 112356627 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000053666] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]
Predicted Effect probably benign
Transcript: ENSMUST00000028549
SMART Domains Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 8e-3 SMART
Pfam:AA_permease 190 384 4.1e-25 PFAM
Pfam:AA_permease 453 761 2.3e-43 PFAM
Pfam:SLC12 773 897 7.1e-20 PFAM
Pfam:SLC12 892 1150 3.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053666
SMART Domains Protein: ENSMUSP00000051490
Gene: ENSMUSG00000027130

DomainStartEndE-ValueType
Pfam:AA_permease 139 333 2.3e-25 PFAM
Pfam:AA_permease_2 385 668 1.5e-19 PFAM
Pfam:AA_permease 391 710 4.5e-41 PFAM
low complexity region 828 842 N/A INTRINSIC
Pfam:KCl_Cotrans_1 967 996 2.2e-23 PFAM
low complexity region 1079 1091 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110987
SMART Domains Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 4e-3 SMART
Pfam:AA_permease 175 369 3.9e-25 PFAM
Pfam:AA_permease_2 421 704 3.2e-19 PFAM
Pfam:AA_permease 426 746 5.8e-41 PFAM
low complexity region 864 878 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110991
SMART Domains Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 7e-3 SMART
Pfam:AA_permease 190 384 4.2e-25 PFAM
Pfam:AA_permease_2 436 719 2.9e-19 PFAM
Pfam:AA_permease 442 761 8.2e-41 PFAM
low complexity region 879 893 N/A INTRINSIC
Pfam:KCl_Cotrans_1 1018 1047 2.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137896
Predicted Effect probably benign
Transcript: ENSMUST00000141047
SMART Domains Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 8e-3 SMART
Pfam:AA_permease 175 369 6.6e-25 PFAM
Pfam:AA_permease 438 746 3.6e-43 PFAM
Pfam:SLC12 758 884 6.8e-20 PFAM
Pfam:SLC12 877 1033 5.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156470
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 91.0%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,671,268 P768S probably damaging Het
Adprhl1 A G 8: 13,224,889 L623P possibly damaging Het
Anapc1 A T 2: 128,607,175 probably benign Het
Ankzf1 C A 1: 75,195,978 probably benign Het
Ash1l A G 3: 88,982,323 D503G probably damaging Het
Atp7b T C 8: 22,015,869 probably null Het
Bach1 T A 16: 87,719,318 V249D possibly damaging Het
Ccdc158 A G 5: 92,657,892 S335P probably benign Het
Chd9 T A 8: 91,006,626 C1374* probably null Het
Col16a1 C T 4: 130,079,195 T643M probably benign Het
Cygb A G 11: 116,650,014 F49L probably benign Het
Dnah17 G C 11: 118,080,766 T2147S probably damaging Het
Drd3 C A 16: 43,762,246 A34E possibly damaging Het
Ephb6 G A 6: 41,618,107 R685Q probably benign Het
Ezh1 G A 11: 101,199,237 probably benign Het
Gpr19 T A 6: 134,869,917 K231* probably null Het
Gpr61 A G 3: 108,150,667 V226A possibly damaging Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Hnrnpul2 A G 19: 8,822,825 K185R possibly damaging Het
Igsf9 A C 1: 172,490,712 T140P probably damaging Het
Ksr2 A G 5: 117,500,792 D87G probably benign Het
Llgl2 A G 11: 115,853,424 E843G probably damaging Het
Ltbp4 GT G 7: 27,327,685 probably null Het
Luc7l2 A G 6: 38,585,101 I20V possibly damaging Het
Mcm6 G A 1: 128,343,427 T485M probably damaging Het
Miox A G 15: 89,335,564 D85G probably null Het
Nudt18 T C 14: 70,579,463 F169S probably benign Het
Nxpe4 A G 9: 48,392,885 N91D probably benign Het
Olfr1089 T G 2: 86,732,746 I289L probably benign Het
Olfr155 T C 4: 43,854,596 S96P probably benign Het
Olfr811 A G 10: 129,801,793 V244A probably benign Het
Pdss2 G T 10: 43,222,005 A82S probably damaging Het
Ptprs T C 17: 56,419,070 D998G probably damaging Het
Rasd2 C A 8: 75,221,975 N176K probably damaging Het
Serpinb3a A G 1: 107,046,330 F284L probably damaging Het
Skint6 T A 4: 113,171,533 probably null Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Sp2 A T 11: 96,955,832 C562S probably damaging Het
Specc1 A G 11: 62,118,957 E433G possibly damaging Het
Sspo C T 6: 48,452,280 Q451* probably null Het
St6galnac1 A T 11: 116,765,880 S478T probably damaging Het
Steap4 C T 5: 7,976,699 R221* probably null Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Vmn1r202 A T 13: 22,502,205 F14Y probably damaging Het
Vmn2r79 T C 7: 87,037,340 V643A probably benign Het
Vmn2r91 C A 17: 18,110,060 Y535* probably null Het
Wdr3 A T 3: 100,141,620 probably benign Het
Wdr95 T C 5: 149,544,801 M41T probably benign Het
Other mutations in Slc12a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Slc12a6 APN 2 112353064 splice site probably null
IGL02573:Slc12a6 APN 2 112358641 critical splice donor site probably null
R0548:Slc12a6 UTSW 2 112335924 critical splice donor site probably null
R1495:Slc12a6 UTSW 2 112354190 missense probably damaging 0.99
R1726:Slc12a6 UTSW 2 112347426 missense probably damaging 1.00
R1856:Slc12a6 UTSW 2 112335927 splice site probably null
R1958:Slc12a6 UTSW 2 112355158 missense possibly damaging 0.92
R2112:Slc12a6 UTSW 2 112356485 missense probably damaging 1.00
R2865:Slc12a6 UTSW 2 112347317 missense probably benign 0.09
R3888:Slc12a6 UTSW 2 112267030 missense possibly damaging 0.76
R4412:Slc12a6 UTSW 2 112335888 missense possibly damaging 0.95
R4655:Slc12a6 UTSW 2 112357766 critical splice acceptor site probably null
R4669:Slc12a6 UTSW 2 112354295 missense probably damaging 1.00
R4928:Slc12a6 UTSW 2 112352961 missense probably damaging 1.00
R4974:Slc12a6 UTSW 2 112358525 missense probably damaging 1.00
R5372:Slc12a6 UTSW 2 112347360 nonsense probably null
R5405:Slc12a6 UTSW 2 112339379 missense probably damaging 1.00
R5786:Slc12a6 UTSW 2 112284722 missense probably benign 0.01
R5836:Slc12a6 UTSW 2 112341998 missense possibly damaging 0.62
R6280:Slc12a6 UTSW 2 112337358 missense probably damaging 1.00
R6310:Slc12a6 UTSW 2 112335839 missense probably damaging 1.00
R6525:Slc12a6 UTSW 2 112352451 missense probably damaging 1.00
R6597:Slc12a6 UTSW 2 112352935 missense probably damaging 1.00
R6723:Slc12a6 UTSW 2 112337942 missense probably damaging 1.00
R6895:Slc12a6 UTSW 2 112355095 missense probably damaging 1.00
R7059:Slc12a6 UTSW 2 112352912 missense probably damaging 0.99
R7188:Slc12a6 UTSW 2 112334415 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGGTTTGGCGGAAATGCAG -3'
(R):5'- TGGGACCTATGTAAGAGATGTGTAG -3'

Sequencing Primer
(F):5'- TGCAGCATACGGATCTTCACAGTAG -3'
(R):5'- TGATGCCTCAAATTCAGGTCCAGAG -3'
Posted On2016-05-10