Incidental Mutation 'R0467:Anapc1'
ID 41680
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Name anaphase promoting complex subunit 1
Synonyms Apc1, tsg24, Mcpr, 2610021O03Rik
MMRRC Submission 038667-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0467 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 128452024-128529311 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128510963 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 511 (I511T)
Ref Sequence ENSEMBL: ENSMUSP00000105962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]
AlphaFold P53995
Predicted Effect probably damaging
Transcript: ENSMUST00000014499
AA Change: I511T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: I511T

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110333
AA Change: I511T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: I511T

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Meta Mutation Damage Score 0.1992 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,532,151 (GRCm39) probably benign Het
Atf6 A T 1: 170,621,589 (GRCm39) H477Q probably damaging Het
C4b A G 17: 34,955,101 (GRCm39) V795A probably benign Het
Cdh26 C T 2: 178,123,425 (GRCm39) R675C possibly damaging Het
Cdk12 T C 11: 98,094,405 (GRCm39) V71A probably damaging Het
Cul3 A T 1: 80,258,580 (GRCm39) D419E probably benign Het
Ddi2 A G 4: 141,412,495 (GRCm39) I139T probably benign Het
Dnaaf1 T A 8: 120,317,471 (GRCm39) D333E probably benign Het
Dnase1 A G 16: 3,857,013 (GRCm39) D7G probably damaging Het
G3bp1 T C 11: 55,389,452 (GRCm39) F383L probably damaging Het
Galc A C 12: 98,208,904 (GRCm39) I250R probably damaging Het
Garin1b G A 6: 29,326,606 (GRCm39) S241N probably damaging Het
Gcfc2 T C 6: 81,900,863 (GRCm39) V59A possibly damaging Het
Gm6133 A C 18: 78,393,305 (GRCm39) S100R probably benign Het
Iba57 T C 11: 59,054,265 (GRCm39) T85A probably benign Het
Ipo4 A T 14: 55,872,983 (GRCm39) M1K probably null Het
Ippk A G 13: 49,584,341 (GRCm39) probably null Het
Kcnk10 A T 12: 98,456,204 (GRCm39) I209N probably benign Het
Klk14 T C 7: 43,343,534 (GRCm39) L122P probably benign Het
Ltbp1 T A 17: 75,589,424 (GRCm39) probably null Het
Mab21l4 A T 1: 93,080,766 (GRCm39) I380N probably damaging Het
Mcm3 T C 1: 20,875,071 (GRCm39) D737G probably benign Het
Naip2 A C 13: 100,298,290 (GRCm39) I582S probably benign Het
Nalcn T A 14: 123,528,459 (GRCm39) T1456S probably benign Het
Nckap1l C T 15: 103,405,854 (GRCm39) P1097S probably benign Het
Ncoa1 A G 12: 4,317,687 (GRCm39) M1215T possibly damaging Het
Nomo1 T A 7: 45,721,911 (GRCm39) probably null Het
Obox5 T A 7: 15,491,932 (GRCm39) C116S possibly damaging Het
Or2ag2b T A 7: 106,417,568 (GRCm39) S93T possibly damaging Het
Or51a43 C T 7: 103,717,332 (GRCm39) R302H probably benign Het
Or5a1 C A 19: 12,097,900 (GRCm39) A59S probably benign Het
Pcdhb14 G T 18: 37,582,277 (GRCm39) R461L probably damaging Het
Pdgfra A G 5: 75,355,697 (GRCm39) D1069G probably damaging Het
Pgr C T 9: 8,900,779 (GRCm39) A104V possibly damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Potegl A G 2: 23,102,832 (GRCm39) E190G possibly damaging Het
Rassf3 A G 10: 121,253,109 (GRCm39) probably benign Het
Rgs22 G T 15: 36,099,941 (GRCm39) S258* probably null Het
Rsph6a C A 7: 18,791,594 (GRCm39) D254E possibly damaging Het
Sgk1 A G 10: 21,872,257 (GRCm39) probably benign Het
Shcbp1l G A 1: 153,308,928 (GRCm39) C174Y probably damaging Het
Spata31g1 T C 4: 42,972,715 (GRCm39) S683P probably benign Het
Sulf1 T A 1: 12,867,144 (GRCm39) N109K probably damaging Het
Taf7l2 G A 10: 115,949,058 (GRCm39) A156V probably benign Het
Tas2r115 T A 6: 132,714,682 (GRCm39) I90L probably benign Het
Tmem200a T C 10: 25,870,002 (GRCm39) H89R probably benign Het
Ubxn4 G A 1: 128,190,641 (GRCm39) E256K probably benign Het
Xrn1 T C 9: 95,906,244 (GRCm39) S1212P probably damaging Het
Zfp408 T C 2: 91,475,882 (GRCm39) Y424C possibly damaging Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128,487,050 (GRCm39) splice site probably benign
IGL00704:Anapc1 APN 2 128,505,904 (GRCm39) missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128,471,649 (GRCm39) missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128,475,328 (GRCm39) missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128,495,090 (GRCm39) missense probably benign
IGL02089:Anapc1 APN 2 128,505,853 (GRCm39) missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128,501,772 (GRCm39) missense probably benign
IGL02570:Anapc1 APN 2 128,487,120 (GRCm39) missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128,465,851 (GRCm39) missense probably benign 0.02
IGL02726:Anapc1 APN 2 128,501,705 (GRCm39) missense probably benign 0.05
IGL03265:Anapc1 APN 2 128,469,117 (GRCm39) missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128,469,033 (GRCm39) splice site probably benign
IGL03327:Anapc1 APN 2 128,465,854 (GRCm39) missense probably benign 0.00
R0023:Anapc1 UTSW 2 128,520,138 (GRCm39) missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128,483,431 (GRCm39) missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128,483,431 (GRCm39) missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128,465,886 (GRCm39) splice site probably benign
R0103:Anapc1 UTSW 2 128,522,372 (GRCm39) splice site probably benign
R0103:Anapc1 UTSW 2 128,522,372 (GRCm39) splice site probably benign
R0109:Anapc1 UTSW 2 128,476,613 (GRCm39) missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128,476,613 (GRCm39) missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128,470,549 (GRCm39) missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128,470,549 (GRCm39) missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128,476,631 (GRCm39) missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128,483,260 (GRCm39) critical splice donor site probably null
R0514:Anapc1 UTSW 2 128,474,575 (GRCm39) missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128,461,252 (GRCm39) missense probably benign 0.17
R0919:Anapc1 UTSW 2 128,459,651 (GRCm39) missense probably benign
R1175:Anapc1 UTSW 2 128,522,108 (GRCm39) missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128,459,617 (GRCm39) missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128,459,476 (GRCm39) missense probably benign 0.44
R1556:Anapc1 UTSW 2 128,466,819 (GRCm39) missense probably benign 0.00
R1567:Anapc1 UTSW 2 128,459,636 (GRCm39) missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128,470,452 (GRCm39) missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128,500,166 (GRCm39) critical splice donor site probably null
R1677:Anapc1 UTSW 2 128,518,128 (GRCm39) missense probably benign 0.09
R1854:Anapc1 UTSW 2 128,517,810 (GRCm39) missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128,501,708 (GRCm39) missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128,475,335 (GRCm39) missense probably benign 0.36
R1984:Anapc1 UTSW 2 128,511,608 (GRCm39) missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128,490,378 (GRCm39) missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128,484,468 (GRCm39) missense probably benign 0.23
R2928:Anapc1 UTSW 2 128,522,057 (GRCm39) missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128,484,602 (GRCm39) missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128,484,439 (GRCm39) missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128,469,149 (GRCm39) intron probably benign
R4359:Anapc1 UTSW 2 128,465,476 (GRCm39) missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128,518,169 (GRCm39) critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128,469,115 (GRCm39) missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128,505,925 (GRCm39) missense probably benign 0.05
R4770:Anapc1 UTSW 2 128,527,980 (GRCm39) splice site probably benign
R4824:Anapc1 UTSW 2 128,470,610 (GRCm39) missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128,526,514 (GRCm39) missense probably benign 0.23
R5016:Anapc1 UTSW 2 128,449,095 (GRCm39) unclassified probably benign
R5063:Anapc1 UTSW 2 128,471,469 (GRCm39) missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128,501,837 (GRCm39) missense probably benign
R5271:Anapc1 UTSW 2 128,527,905 (GRCm39) nonsense probably null
R5363:Anapc1 UTSW 2 128,492,114 (GRCm39) critical splice donor site probably null
R5469:Anapc1 UTSW 2 128,517,621 (GRCm39) nonsense probably null
R5473:Anapc1 UTSW 2 128,449,115 (GRCm39) unclassified probably benign
R5559:Anapc1 UTSW 2 128,522,354 (GRCm39) nonsense probably null
R5631:Anapc1 UTSW 2 128,499,137 (GRCm39) missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128,466,836 (GRCm39) missense probably benign 0.19
R5840:Anapc1 UTSW 2 128,448,957 (GRCm39) unclassified probably benign
R6226:Anapc1 UTSW 2 128,492,292 (GRCm39) missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128,514,055 (GRCm39) nonsense probably null
R6561:Anapc1 UTSW 2 128,505,919 (GRCm39) missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128,526,454 (GRCm39) nonsense probably null
R6799:Anapc1 UTSW 2 128,501,657 (GRCm39) missense probably null 0.38
R6887:Anapc1 UTSW 2 128,501,688 (GRCm39) missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128,511,820 (GRCm39) missense probably benign 0.06
R7011:Anapc1 UTSW 2 128,490,601 (GRCm39) splice site probably null
R7041:Anapc1 UTSW 2 128,470,576 (GRCm39) missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128,457,350 (GRCm39) missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128,520,194 (GRCm39) missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128,516,522 (GRCm39) missense probably benign 0.33
R7123:Anapc1 UTSW 2 128,454,930 (GRCm39) missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128,516,604 (GRCm39) missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128,483,457 (GRCm39) missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128,526,528 (GRCm39) missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128,511,828 (GRCm39) missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128,516,513 (GRCm39) missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128,490,408 (GRCm39) missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128,474,547 (GRCm39) missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128,461,837 (GRCm39) nonsense probably null
R8402:Anapc1 UTSW 2 128,472,148 (GRCm39) missense probably benign 0.02
R8422:Anapc1 UTSW 2 128,517,757 (GRCm39) missense probably benign
R8425:Anapc1 UTSW 2 128,511,788 (GRCm39) missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128,500,264 (GRCm39) splice site probably null
R8553:Anapc1 UTSW 2 128,461,833 (GRCm39) missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128,527,748 (GRCm39) missense probably benign 0.19
R8699:Anapc1 UTSW 2 128,483,373 (GRCm39) missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128,483,369 (GRCm39) missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128,499,093 (GRCm39) missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128,499,093 (GRCm39) missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128,464,333 (GRCm39) missense possibly damaging 0.67
R8973:Anapc1 UTSW 2 128,505,952 (GRCm39) missense probably damaging 0.99
R8977:Anapc1 UTSW 2 128,483,322 (GRCm39) missense probably damaging 1.00
R9000:Anapc1 UTSW 2 128,476,628 (GRCm39) missense probably damaging 1.00
R9080:Anapc1 UTSW 2 128,464,426 (GRCm39) missense possibly damaging 0.82
R9203:Anapc1 UTSW 2 128,465,422 (GRCm39) missense possibly damaging 0.66
R9314:Anapc1 UTSW 2 128,464,420 (GRCm39) missense possibly damaging 0.69
R9386:Anapc1 UTSW 2 128,459,642 (GRCm39) missense probably benign 0.08
R9415:Anapc1 UTSW 2 128,476,598 (GRCm39) missense probably benign
R9436:Anapc1 UTSW 2 128,518,045 (GRCm39) missense probably benign
R9516:Anapc1 UTSW 2 128,517,633 (GRCm39) missense possibly damaging 0.77
R9563:Anapc1 UTSW 2 128,505,980 (GRCm39) nonsense probably null
R9572:Anapc1 UTSW 2 128,505,976 (GRCm39) missense probably benign
R9757:Anapc1 UTSW 2 128,517,676 (GRCm39) missense probably damaging 1.00
R9766:Anapc1 UTSW 2 128,500,221 (GRCm39) missense probably damaging 1.00
X0066:Anapc1 UTSW 2 128,516,621 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTCTCACAGCACAAAGGAGGTCAG -3'
(R):5'- AGGCAGGGTCTCACCTAGTAGTACAG -3'

Sequencing Primer
(F):5'- GCAGAATCTCCCACCTGTG -3'
(R):5'- cctctccactctctctccac -3'
Posted On 2013-05-23