Incidental Mutation 'R5531:9930021J03Rik'
ID433723
Institutional Source Beutler Lab
Gene Symbol 9930021J03Rik
Ensembl Gene ENSMUSG00000046138
Gene NameRIKEN cDNA 9930021J03 gene
SynonymsGm9832
MMRRC Submission 043089-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R5531 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location29714402-29805989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29753672 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 647 (S647P)
Ref Sequence ENSEMBL: ENSMUSP00000135473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177155]
Predicted Effect unknown
Transcript: ENSMUST00000175726
AA Change: S591P
Predicted Effect probably benign
Transcript: ENSMUST00000175764
SMART Domains Protein: ENSMUSP00000135031
Gene: ENSMUSG00000046138

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 379 393 N/A INTRINSIC
internal_repeat_1 397 526 2.65e-5 PROSPERO
low complexity region 528 537 N/A INTRINSIC
low complexity region 619 648 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 835 857 N/A INTRINSIC
low complexity region 880 896 N/A INTRINSIC
low complexity region 965 978 N/A INTRINSIC
internal_repeat_1 999 1143 2.65e-5 PROSPERO
low complexity region 1220 1226 N/A INTRINSIC
low complexity region 1246 1260 N/A INTRINSIC
low complexity region 1286 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176773
Predicted Effect possibly damaging
Transcript: ENSMUST00000177155
AA Change: S647P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135473
Gene: ENSMUSG00000046138
AA Change: S647P

DomainStartEndE-ValueType
low complexity region 4 66 N/A INTRINSIC
BROMO 75 198 1.22e-3 SMART
low complexity region 205 219 N/A INTRINSIC
low complexity region 280 298 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
coiled coil region 606 638 N/A INTRINSIC
low complexity region 655 689 N/A INTRINSIC
coiled coil region 697 729 N/A INTRINSIC
low complexity region 1079 1093 N/A INTRINSIC
internal_repeat_1 1097 1226 1.32e-7 PROSPERO
low complexity region 1228 1237 N/A INTRINSIC
low complexity region 1319 1348 N/A INTRINSIC
low complexity region 1401 1416 N/A INTRINSIC
low complexity region 1535 1557 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
low complexity region 1665 1678 N/A INTRINSIC
internal_repeat_1 1699 1843 1.32e-7 PROSPERO
low complexity region 1920 1926 N/A INTRINSIC
low complexity region 1946 1960 N/A INTRINSIC
low complexity region 1986 2004 N/A INTRINSIC
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.5%
  • 10x: 95.6%
  • 20x: 92.2%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,204,706 F878L possibly damaging Het
Acr T A 15: 89,573,943 Y276N probably damaging Het
AI987944 A T 7: 41,374,390 Y388* probably null Het
Ankrd29 G A 18: 12,279,778 T114I probably damaging Het
Ap5z1 T C 5: 142,467,781 M168T probably benign Het
Bard1 A C 1: 71,046,721 C608W probably damaging Het
Clspn A G 4: 126,577,773 R907G probably benign Het
Cubn C T 2: 13,350,932 V1830I probably benign Het
Cwc22 T C 2: 77,924,569 N221S probably damaging Het
Dact3 A G 7: 16,875,615 E64G possibly damaging Het
Dhx40 T C 11: 86,789,504 E381G possibly damaging Het
Dnah7a A G 1: 53,419,748 S3744P possibly damaging Het
Epha4 A G 1: 77,374,876 V914A probably benign Het
Fbxw10 G A 11: 62,862,656 C492Y probably damaging Het
G930045G22Rik C A 6: 50,847,776 noncoding transcript Het
Gm21103 A T 14: 6,303,861 I63K probably damaging Het
Gpr156 T C 16: 38,005,257 V612A probably benign Het
Gucy2g A G 19: 55,241,140 S33P probably benign Het
Hibch A G 1: 52,845,069 probably benign Het
Hmcn1 A T 1: 150,743,788 C1192S probably damaging Het
Hsd11b1 CGG CG 1: 193,240,249 probably null Het
Ifi214 A G 1: 173,525,120 Y248H probably damaging Het
Igf2bp2 T G 16: 22,089,085 I89L probably damaging Het
Il2ra A T 2: 11,676,892 T103S possibly damaging Het
Ino80 T A 2: 119,445,575 M407L probably benign Het
Jade1 A C 3: 41,613,511 K671N probably benign Het
Lca5 C T 9: 83,398,595 S384N probably benign Het
Lce1l G T 3: 92,850,497 P18H unknown Het
Lrrc8d T C 5: 105,797,670 probably benign Het
Ly75 T C 2: 60,365,145 N223S probably damaging Het
Mcm3 A T 1: 20,803,544 F784Y possibly damaging Het
Ncf4 T G 15: 78,260,788 probably benign Het
Ncoa1 T A 12: 4,253,746 M1362L probably benign Het
Olfr1 T C 11: 73,395,177 T282A probably benign Het
Olfr467 A G 7: 107,815,244 Y220C probably benign Het
Olfr765 G C 10: 129,046,564 F166L probably damaging Het
Prkg2 T C 5: 98,967,734 R543G probably damaging Het
Ptprd A C 4: 76,059,667 probably null Het
Scap A G 9: 110,381,429 S969G possibly damaging Het
Sgk2 T C 2: 162,994,704 F60S probably benign Het
Sgpp1 G T 12: 75,735,207 Y119* probably null Het
Siglech A T 7: 55,768,665 K31* probably null Het
Slc40a1 A G 1: 45,912,338 Y220H probably damaging Het
Smurf2 G A 11: 106,852,563 T219M possibly damaging Het
Speer4f2 A G 5: 17,376,528 K156R possibly damaging Het
Spp1 T G 5: 104,440,558 D276E probably benign Het
Stk32b T C 5: 37,459,734 probably null Het
Stxbp5 G A 10: 9,762,924 Q1044* probably null Het
Sv2c T A 13: 95,961,378 T696S probably damaging Het
Tubgcp2 A C 7: 140,005,024 probably null Het
Ubap1l C T 9: 65,371,691 P91S probably damaging Het
Vmn2r76 A T 7: 86,225,449 D773E probably damaging Het
Xirp2 C G 2: 67,515,302 S2629C probably benign Het
Zbtb20 C A 16: 43,610,867 C580* probably null Het
Zfp957 T A 14: 79,213,182 Q392H unknown Het
Zfyve19 C T 2: 119,211,946 T178M probably damaging Het
Zswim6 T C 13: 107,769,593 noncoding transcript Het
Other mutations in 9930021J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:9930021J03Rik APN 19 29754020 missense probably benign 0.33
IGL01535:9930021J03Rik APN 19 29753812 missense possibly damaging 0.53
IGL02019:9930021J03Rik APN 19 29717063 missense probably benign 0.28
IGL02034:9930021J03Rik APN 19 29716859 missense possibly damaging 0.73
IGL03114:9930021J03Rik APN 19 29717132 missense probably benign 0.18
IGL03382:9930021J03Rik APN 19 29717276 missense probably damaging 1.00
R0020:9930021J03Rik UTSW 19 29716197 missense probably damaging 0.98
R0020:9930021J03Rik UTSW 19 29716197 missense probably damaging 0.98
R0142:9930021J03Rik UTSW 19 29718254 missense possibly damaging 0.93
R0178:9930021J03Rik UTSW 19 29754788 missense probably damaging 1.00
R0453:9930021J03Rik UTSW 19 29753668 missense probably damaging 1.00
R0730:9930021J03Rik UTSW 19 29717981 missense probably benign 0.00
R0735:9930021J03Rik UTSW 19 29717638 missense possibly damaging 0.92
R0891:9930021J03Rik UTSW 19 29717653 missense probably damaging 1.00
R0894:9930021J03Rik UTSW 19 29720574 splice site probably benign
R1289:9930021J03Rik UTSW 19 29723452 missense probably benign 0.07
R1368:9930021J03Rik UTSW 19 29716396 missense probably damaging 0.97
R1387:9930021J03Rik UTSW 19 29723453 missense probably benign 0.15
R1483:9930021J03Rik UTSW 19 29719345 missense possibly damaging 0.93
R1526:9930021J03Rik UTSW 19 29735145 missense probably damaging 1.00
R1612:9930021J03Rik UTSW 19 29717845 missense possibly damaging 0.86
R1721:9930021J03Rik UTSW 19 29743598 missense probably damaging 0.99
R1764:9930021J03Rik UTSW 19 29719160 missense possibly damaging 0.53
R1822:9930021J03Rik UTSW 19 29716414 missense probably damaging 0.99
R1824:9930021J03Rik UTSW 19 29716414 missense probably damaging 0.99
R1859:9930021J03Rik UTSW 19 29754923 missense possibly damaging 0.53
R1868:9930021J03Rik UTSW 19 29743598 missense probably damaging 0.99
R1880:9930021J03Rik UTSW 19 29718123 missense probably benign 0.06
R1898:9930021J03Rik UTSW 19 29735132 missense possibly damaging 0.74
R1936:9930021J03Rik UTSW 19 29753677 missense possibly damaging 0.87
R1939:9930021J03Rik UTSW 19 29753677 missense possibly damaging 0.87
R1969:9930021J03Rik UTSW 19 29716675 missense possibly damaging 0.95
R2153:9930021J03Rik UTSW 19 29716829 missense probably benign 0.01
R2366:9930021J03Rik UTSW 19 29753635 missense probably damaging 0.99
R2379:9930021J03Rik UTSW 19 29718875 missense probably benign 0.01
R3107:9930021J03Rik UTSW 19 29723447 missense probably damaging 1.00
R4012:9930021J03Rik UTSW 19 29743590 missense probably damaging 1.00
R4222:9930021J03Rik UTSW 19 29718749 missense probably benign 0.18
R4328:9930021J03Rik UTSW 19 29743561 missense probably benign 0.00
R4329:9930021J03Rik UTSW 19 29743561 missense probably benign 0.00
R4387:9930021J03Rik UTSW 19 29805315 unclassified probably benign
R4688:9930021J03Rik UTSW 19 29717101 missense probably benign 0.33
R4796:9930021J03Rik UTSW 19 29753618 missense probably benign 0.33
R4820:9930021J03Rik UTSW 19 29718409 missense possibly damaging 0.53
R4832:9930021J03Rik UTSW 19 29717216 missense possibly damaging 0.53
R5056:9930021J03Rik UTSW 19 29717359 missense probably benign
R5150:9930021J03Rik UTSW 19 29805550 missense probably damaging 0.96
R5224:9930021J03Rik UTSW 19 29719050 missense possibly damaging 0.73
R5306:9930021J03Rik UTSW 19 29729830 intron probably benign
R5460:9930021J03Rik UTSW 19 29754850 missense probably damaging 0.98
R5477:9930021J03Rik UTSW 19 29754118 missense probably benign 0.33
R5559:9930021J03Rik UTSW 19 29716963 missense possibly damaging 0.91
R5647:9930021J03Rik UTSW 19 29753810 missense possibly damaging 0.73
R5886:9930021J03Rik UTSW 19 29719277 missense probably benign 0.03
R6029:9930021J03Rik UTSW 19 29754967 unclassified probably benign
R6240:9930021J03Rik UTSW 19 29717240 missense probably benign 0.18
R6331:9930021J03Rik UTSW 19 29717747 missense probably benign 0.33
R6456:9930021J03Rik UTSW 19 29716514 missense possibly damaging 0.93
R6584:9930021J03Rik UTSW 19 29718728 missense possibly damaging 0.53
R6661:9930021J03Rik UTSW 19 29723464 missense possibly damaging 0.53
R6991:9930021J03Rik UTSW 19 29719108 missense possibly damaging 0.86
R7059:9930021J03Rik UTSW 19 29719545 missense probably benign 0.33
R7128:9930021J03Rik UTSW 19 29716481 missense possibly damaging 0.53
R7211:9930021J03Rik UTSW 19 29786312 missense
X0027:9930021J03Rik UTSW 19 29735199 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAAATAAAGCTTGACTCTCACACAC -3'
(R):5'- CATTGATCATCCAGACATTAACTGC -3'

Sequencing Primer
(F):5'- GCTTGACTCTCACACACATAAG -3'
(R):5'- CATTAACTGCCACAAAGTTGTAAGGG -3'
Posted On2016-10-06