Incidental Mutation 'R5473:Gorasp2'
ID433907
Institutional Source Beutler Lab
Gene Symbol Gorasp2
Ensembl Gene ENSMUSG00000014959
Gene Namegolgi reassembly stacking protein 2
SynonymsGRASP55, GRS2, 9430094F20Rik, 5730520M13Rik, GOLPH2, p59, ENSMUSG00000075299
MMRRC Submission 043034-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5473 (G1)
Quality Score224
Status Validated
Chromosome2
Chromosomal Location70661576-70712636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 70678606 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 123 (M123L)
Ref Sequence ENSEMBL: ENSMUSP00000107820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028509] [ENSMUST00000112201] [ENSMUST00000112205] [ENSMUST00000133432]
Predicted Effect probably benign
Transcript: ENSMUST00000028509
AA Change: M143L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028509
Gene: ENSMUSG00000014959
AA Change: M143L

DomainStartEndE-ValueType
PDZ 5 75 8.14e-1 SMART
internal_repeat_1 107 196 4.52e-17 PROSPERO
low complexity region 236 252 N/A INTRINSIC
low complexity region 307 329 N/A INTRINSIC
low complexity region 333 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112201
AA Change: M123L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107820
Gene: ENSMUSG00000014959
AA Change: M123L

DomainStartEndE-ValueType
Pfam:GRASP55_65 1 62 4.6e-11 PFAM
Pfam:GRASP55_65 49 185 1.9e-65 PFAM
low complexity region 216 232 N/A INTRINSIC
low complexity region 287 309 N/A INTRINSIC
low complexity region 313 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112205
AA Change: M143L

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107824
Gene: ENSMUSG00000014959
AA Change: M143L

DomainStartEndE-ValueType
PDZ 5 75 3.9e-3 SMART
internal_repeat_1 107 196 7.65e-17 PROSPERO
low complexity region 236 252 N/A INTRINSIC
low complexity region 307 329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130970
Predicted Effect probably benign
Transcript: ENSMUST00000133432
AA Change: M143L

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121549
Gene: ENSMUSG00000014959
AA Change: M143L

DomainStartEndE-ValueType
PDZ 5 75 8.14e-1 SMART
internal_repeat_1 107 196 1.1e-15 PROSPERO
low complexity region 236 252 N/A INTRINSIC
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi reassembly stacking protein family. These proteins may play a role in the stacking of Golgi cisternae and Golgi ribbon formation, as well as Golgi fragmentation during apoptosis or mitosis. The encoded protein also plays a role in the intracellular transport of transforming growth factor alpha and may function as a molecular chaperone. A pseudogene of this gene is located on the short arm of chromosome 2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T C 7: 119,712,950 Y549H probably damaging Het
Adamtsl4 G T 3: 95,679,993 Q758K probably damaging Het
Anapc1 G T 2: 128,607,195 probably benign Het
Ankrd26 A T 6: 118,515,836 C1316S probably benign Het
Birc5 T C 11: 117,852,707 V89A possibly damaging Het
Camk2d G T 3: 126,597,399 probably benign Het
Ccdc47 A T 11: 106,205,029 S280R probably damaging Het
Cntnap5a T A 1: 116,089,256 F193Y probably benign Het
Cntrob G T 11: 69,322,753 D70E possibly damaging Het
Col24a1 A C 3: 145,537,261 M1519L probably benign Het
Col2a1 G T 15: 97,987,489 A491D unknown Het
Crat A G 2: 30,407,714 L266P probably damaging Het
Dlgap1 A T 17: 70,517,030 probably benign Het
Eya4 T A 10: 23,163,453 H104L probably benign Het
Fam83b T C 9: 76,491,500 K774E probably damaging Het
Fgd6 T C 10: 94,044,676 I464T probably benign Het
H2-M10.3 A T 17: 36,367,369 V188E probably damaging Het
Hnrnpk A T 13: 58,394,099 W333R probably damaging Het
Hrh4 T C 18: 13,021,928 Y175H probably benign Het
Igf2r G T 17: 12,695,314 T1756K probably benign Het
Kcnq5 A G 1: 21,457,402 probably null Het
Kiz G T 2: 146,969,995 E675* probably null Het
Mcm3ap T G 10: 76,502,759 L1407R probably damaging Het
Mdc1 A G 17: 35,848,060 D444G probably benign Het
Myl3 C A 9: 110,767,958 H129N probably damaging Het
Neo1 T C 9: 58,880,843 N1309S possibly damaging Het
Nrxn1 A T 17: 90,590,092 Y269N probably damaging Het
Nsd1 A G 13: 55,247,772 N1165S probably damaging Het
Nuf2 T C 1: 169,507,287 D302G probably benign Het
Olfr1166 A T 2: 88,124,637 M116K possibly damaging Het
Olfr125 T C 17: 37,835,739 F247L probably benign Het
Olfr218 G C 1: 173,204,165 G270R probably benign Het
Olfr908 A G 9: 38,516,212 Y60C probably damaging Het
Oxsm A T 14: 16,242,045 S241R probably damaging Het
Pde1a G T 2: 79,906,028 S87R probably damaging Het
Plagl2 A T 2: 153,232,194 C262* probably null Het
Plcg2 A G 8: 117,634,401 K1233R probably benign Het
Pon3 A T 6: 5,256,177 I17K possibly damaging Het
Ppfia1 A T 7: 144,491,492 M951K probably benign Het
Pramef8 A G 4: 143,419,304 R448G probably damaging Het
Prpf31 A G 7: 3,639,825 K438E probably benign Het
Pum3 C A 19: 27,418,848 V328F probably damaging Het
Ralgapa1 T C 12: 55,676,710 E1677G probably benign Het
Rpf2 A G 10: 40,227,631 V96A possibly damaging Het
Rsrc2 C T 5: 123,731,087 A98T probably damaging Het
Saraf G A 8: 34,161,258 R86Q probably damaging Het
Scara5 T A 14: 65,740,339 D349E possibly damaging Het
Slc30a1 T C 1: 191,909,622 V460A possibly damaging Het
Tdrd7 G T 4: 46,020,877 V768L possibly damaging Het
Tshz2 T C 2: 169,883,798 S105P probably benign Het
Ufsp2 A G 8: 45,992,221 I362M probably damaging Het
Ugt1a7c T A 1: 88,095,437 I106K probably benign Het
Wdr92 T C 11: 17,224,591 V153A probably damaging Het
Zdhhc5 A G 2: 84,690,466 Y456H probably damaging Het
Other mutations in Gorasp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Gorasp2 APN 2 70690864 missense probably benign
IGL01108:Gorasp2 APN 2 70678578 missense probably damaging 1.00
IGL01611:Gorasp2 APN 2 70689260 missense possibly damaging 0.87
IGL02472:Gorasp2 APN 2 70676459 splice site probably benign
IGL02794:Gorasp2 APN 2 70679494 nonsense probably null
IGL03132:Gorasp2 APN 2 70684035 missense probably benign 0.24
IGL03369:Gorasp2 APN 2 70682992 missense probably damaging 1.00
R0049:Gorasp2 UTSW 2 70690723 missense possibly damaging 0.83
R0049:Gorasp2 UTSW 2 70690723 missense possibly damaging 0.83
R0846:Gorasp2 UTSW 2 70690954 missense probably benign 0.01
R1112:Gorasp2 UTSW 2 70690814 missense probably benign 0.00
R1168:Gorasp2 UTSW 2 70688400 missense probably damaging 1.00
R1862:Gorasp2 UTSW 2 70679464 missense probably damaging 1.00
R4062:Gorasp2 UTSW 2 70679513 missense probably damaging 1.00
R4636:Gorasp2 UTSW 2 70679492 missense probably damaging 1.00
R4911:Gorasp2 UTSW 2 70688339 intron probably benign
R5215:Gorasp2 UTSW 2 70689254 missense probably benign 0.04
R6005:Gorasp2 UTSW 2 70690751 missense probably benign 0.01
R6220:Gorasp2 UTSW 2 70690790 missense probably damaging 1.00
R6358:Gorasp2 UTSW 2 70672760 start codon destroyed probably null 0.00
R7225:Gorasp2 UTSW 2 70684047 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTTCTTCAGACGCTATAGCTCC -3'
(R):5'- GGTGCATGATGGACAAGTGC -3'

Sequencing Primer
(F):5'- CGAGCTGTCACTCTTAACGCG -3'
(R):5'- GTGCAAGGATCCCATGGTTTCC -3'
Posted On2016-10-06