Incidental Mutation 'R5695:Lpin2'
ID443905
Institutional Source Beutler Lab
Gene Symbol Lpin2
Ensembl Gene ENSMUSG00000024052
Gene Namelipin 2
Synonyms2610511G02Rik
MMRRC Submission 043326-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R5695 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71182560-71249817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71244803 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 733 (R733C)
Ref Sequence ENSEMBL: ENSMUSP00000119282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126681] [ENSMUST00000129635]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125665
Predicted Effect probably damaging
Transcript: ENSMUST00000126681
AA Change: R771C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052
AA Change: R771C

DomainStartEndE-ValueType
Pfam:Lipin_N 39 148 1e-47 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Pfam:Lipin_mid 504 596 6.1e-37 PFAM
LNS2 720 876 2.18e-107 SMART
low complexity region 924 930 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129635
AA Change: R733C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052
AA Change: R733C

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
LNS2 682 838 2.18e-107 SMART
low complexity region 886 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133156
Predicted Effect probably benign
Transcript: ENSMUST00000154507
SMART Domains Protein: ENSMUSP00000127035
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_mid 1 55 2.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.596 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop ataxia, impaired blance, and tremors with age and show altered cerebellar phospholipid composition and anemia. Mice show diet-induced hepatic triglyceride accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,613,971 H116L probably damaging Het
Anapc4 C T 5: 52,862,239 S581L probably benign Het
Ano8 A C 8: 71,483,243 D276E probably damaging Het
Aspm G A 1: 139,479,669 R2098H probably benign Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Bpifb4 G A 2: 153,942,923 G184S probably damaging Het
Cbx8 T C 11: 119,039,311 D152G probably benign Het
Cdca2 A G 14: 67,705,629 probably null Het
Cgn G A 3: 94,773,635 A531V probably benign Het
Cmya5 C A 13: 93,045,866 probably null Het
Cntnap3 A G 13: 64,787,955 S365P probably damaging Het
Crnn A G 3: 93,149,023 Q372R probably damaging Het
Ehf T A 2: 103,266,779 E276V probably damaging Het
Eif4g3 T A 4: 138,163,433 probably null Het
Enpep C T 3: 129,309,099 D403N probably damaging Het
Enpp1 T C 10: 24,654,908 E550G probably damaging Het
Entpd8 A G 2: 25,084,334 D377G probably benign Het
Epc2 T A 2: 49,547,607 probably null Het
Erich3 G T 3: 154,733,573 G481V probably damaging Het
Fank1 A G 7: 133,869,346 Y156C probably damaging Het
Fras1 A G 5: 96,781,344 D3869G probably damaging Het
Gcnt2 A G 13: 40,918,199 D106G probably benign Het
Gm20830 A T Y: 6,916,501 V206E probably benign Het
Gmpr2 T C 14: 55,677,234 V228A possibly damaging Het
Gon4l TGAGCA TGAGCAGAGCA 3: 88,896,216 probably null Het
Gtpbp1 G A 15: 79,712,174 probably null Het
Hhat A T 1: 192,717,019 M271K probably damaging Het
Hipk2 A T 6: 38,818,875 M153K possibly damaging Het
Hydin A T 8: 110,535,283 H2672L probably benign Het
Igfbpl1 A T 4: 45,826,374 D140E probably damaging Het
Kctd1 T G 18: 15,063,516 probably benign Het
Lax1 A T 1: 133,680,578 Y142N probably damaging Het
Morn4 A G 19: 42,076,117 L144P possibly damaging Het
Nup214 C A 2: 32,034,373 T1638K probably damaging Het
Nyap1 C T 5: 137,734,984 A596T probably damaging Het
Oas1d T C 5: 120,915,011 M43T probably benign Het
Olfr724 T C 14: 49,960,623 T150A probably benign Het
Olfr901 A G 9: 38,431,176 H298R probably benign Het
Olfr986 T C 9: 40,187,601 V162A probably benign Het
Pacs1 A G 19: 5,136,791 F851S probably damaging Het
Pcdh17 A G 14: 84,446,360 Q89R probably damaging Het
Phrf1 A G 7: 141,258,465 probably benign Het
Plekhb1 A T 7: 100,655,395 I34N probably damaging Het
Ralgapa2 T C 2: 146,333,477 E1800G probably damaging Het
Rbm33 A T 5: 28,339,012 I89F probably damaging Het
Rtl1 T A 12: 109,594,097 E436V probably damaging Het
Slc2a4 G T 11: 69,946,391 P73Q probably damaging Het
Sorbs2 A T 8: 45,792,875 T311S probably benign Het
Sulf2 G A 2: 166,132,758 A2V probably benign Het
Supt16 A T 14: 52,174,144 probably null Het
Vmn1r26 A T 6: 58,008,753 N150K probably damaging Het
Vmn2r39 T A 7: 9,025,151 H407L possibly damaging Het
Vmn2r84 T A 10: 130,389,195 Y482F probably benign Het
Vps9d1 T C 8: 123,246,916 E376G probably benign Het
Wrn C A 8: 33,324,318 G366V probably benign Het
Other mutations in Lpin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lpin2 APN 17 71243972 missense probably damaging 1.00
IGL01712:Lpin2 APN 17 71215068 missense probably damaging 1.00
IGL01727:Lpin2 APN 17 71246452 missense probably damaging 1.00
IGL01969:Lpin2 APN 17 71231507 missense probably benign 0.00
IGL02143:Lpin2 APN 17 71243926 missense probably damaging 1.00
IGL02600:Lpin2 APN 17 71238698 missense probably damaging 0.99
IGL02931:Lpin2 APN 17 71238683 missense probably damaging 1.00
aspen UTSW 17 71243970 nonsense probably null
R0144:Lpin2 UTSW 17 71225076 missense probably damaging 1.00
R0165:Lpin2 UTSW 17 71246519 missense probably damaging 1.00
R0367:Lpin2 UTSW 17 71215022 missense probably damaging 1.00
R0648:Lpin2 UTSW 17 71229312 missense probably benign 0.01
R1564:Lpin2 UTSW 17 71225060 missense probably benign 0.01
R1570:Lpin2 UTSW 17 71245181 nonsense probably null
R1846:Lpin2 UTSW 17 71225069 missense probably benign 0.00
R3607:Lpin2 UTSW 17 71229392 missense probably damaging 1.00
R4006:Lpin2 UTSW 17 71246501 missense probably damaging 1.00
R4526:Lpin2 UTSW 17 71237378 splice site probably null
R4705:Lpin2 UTSW 17 71232143 unclassified probably benign
R4949:Lpin2 UTSW 17 71231339 missense probably damaging 1.00
R4970:Lpin2 UTSW 17 71231334 missense probably damaging 0.98
R5099:Lpin2 UTSW 17 71243970 nonsense probably null
R5100:Lpin2 UTSW 17 71243970 nonsense probably null
R5101:Lpin2 UTSW 17 71243970 nonsense probably null
R5152:Lpin2 UTSW 17 71245159 missense probably damaging 1.00
R5216:Lpin2 UTSW 17 71242760 missense probably damaging 1.00
R5321:Lpin2 UTSW 17 71246858 missense probably damaging 1.00
R5457:Lpin2 UTSW 17 71243372 missense probably damaging 1.00
R5786:Lpin2 UTSW 17 71230273 missense probably benign 0.03
R5869:Lpin2 UTSW 17 71232276 unclassified probably benign
R5894:Lpin2 UTSW 17 71246934 missense probably benign 0.39
R6116:Lpin2 UTSW 17 71243930 missense probably damaging 1.00
R6253:Lpin2 UTSW 17 71231269 missense probably damaging 1.00
R6280:Lpin2 UTSW 17 71232248 unclassified probably benign
R6443:Lpin2 UTSW 17 71241668 missense probably benign 0.25
R6528:Lpin2 UTSW 17 71244005 missense probably damaging 1.00
R6634:Lpin2 UTSW 17 71246418 missense probably damaging 1.00
R6828:Lpin2 UTSW 17 71222128 missense probably damaging 1.00
R6885:Lpin2 UTSW 17 71215150 missense probably damaging 1.00
R6930:Lpin2 UTSW 17 71244791 missense probably damaging 1.00
R7067:Lpin2 UTSW 17 71244858 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGTGTGTACAACCCTAACTGG -3'
(R):5'- TTAATCTCTGGGCACTGTCG -3'

Sequencing Primer
(F):5'- CTAACTGGGTTTCTTCTAAGTTCAG -3'
(R):5'- TTCCTTGCTGGGCCCTGAG -3'
Posted On2016-11-09