Incidental Mutation 'R5883:Cd84'
ID454498
Institutional Source Beutler Lab
Gene Symbol Cd84
Ensembl Gene ENSMUSG00000038147
Gene NameCD84 antigen
SynonymsCDw84, A130013D22Rik, SLAMF5
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5883 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171839697-171890718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 171872838 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 174 (V174A)
Ref Sequence ENSEMBL: ENSMUSP00000120881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042302] [ENSMUST00000136479] [ENSMUST00000155802]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042302
AA Change: V174A

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047024
Gene: ENSMUSG00000038147
AA Change: V174A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128189
Predicted Effect possibly damaging
Transcript: ENSMUST00000136479
AA Change: V174A

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122951
Gene: ENSMUSG00000038147
AA Change: V174A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000155802
AA Change: V174A

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120881
Gene: ENSMUSG00000038147
AA Change: V174A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein that is a member of the signaling lymphocyte activation molecule (SLAM) family. This family forms a subset of the larger CD2 cell-surface receptor Ig superfamily. The encoded protein is a homophilic adhesion molecule that is expressed in numerous immune cells types and is involved in regulating receptor-mediated signaling in those cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of this gene show defects in T follicular helper function and germinal center formation. Mice homozygous for a different knock-out allele display normal platelet physiology and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Cd84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cd84 APN 1 171852137 critical splice donor site probably null
IGL01371:Cd84 APN 1 171886370 missense probably benign 0.36
IGL03035:Cd84 APN 1 171852034 missense probably damaging 0.99
IGL03098:Cd84 APN 1 171872700 missense possibly damaging 0.78
R0511:Cd84 UTSW 1 171872927 missense probably benign 0.00
R1244:Cd84 UTSW 1 171851830 missense probably damaging 0.99
R1438:Cd84 UTSW 1 171852118 missense probably damaging 1.00
R1459:Cd84 UTSW 1 171851943 missense probably benign 0.02
R1654:Cd84 UTSW 1 171884606 missense possibly damaging 0.69
R1658:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1659:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1765:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1771:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1776:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1799:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1815:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1816:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R1982:Cd84 UTSW 1 171884585 splice site probably null
R1990:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2056:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2057:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2058:Cd84 UTSW 1 171872750 missense possibly damaging 0.78
R2098:Cd84 UTSW 1 171885581 missense probably benign 0.07
R4674:Cd84 UTSW 1 171873320 missense possibly damaging 0.82
R4675:Cd84 UTSW 1 171873320 missense possibly damaging 0.82
R4806:Cd84 UTSW 1 171852121 missense probably benign 0.00
R4828:Cd84 UTSW 1 171872748 missense probably damaging 0.97
R4908:Cd84 UTSW 1 171872865 missense probably damaging 0.96
R5366:Cd84 UTSW 1 171873305 missense probably damaging 1.00
R5725:Cd84 UTSW 1 171873361 missense probably benign 0.00
R6722:Cd84 UTSW 1 171872777 missense probably damaging 0.98
R6966:Cd84 UTSW 1 171886409 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTTCAGCTCACTGTAGGCTC -3'
(R):5'- CTCACTTTAAAGGAGGCACATAC -3'

Sequencing Primer
(F):5'- CAGCTCACTGTAGGCTCATATG -3'
(R):5'- TGTGAAGATTAGCCAGAGGTTAAGCC -3'
Posted On2017-02-10