Incidental Mutation 'R5947:Zfp647'
ID472250
Institutional Source Beutler Lab
Gene Symbol Zfp647
Ensembl Gene ENSMUSG00000054967
Gene Namezinc finger protein 647
Synonyms
MMRRC Submission 044138-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5947 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76910371-76925448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76912085 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 125 (P125L)
Ref Sequence ENSEMBL: ENSMUSP00000155272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048854] [ENSMUST00000229055] [ENSMUST00000229865]
Predicted Effect probably benign
Transcript: ENSMUST00000048854
AA Change: P125L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041575
Gene: ENSMUSG00000054967
AA Change: P125L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
KRAB 17 77 7.05e-33 SMART
ZnF_C2H2 174 196 3.39e-3 SMART
ZnF_C2H2 202 224 1.2e-3 SMART
ZnF_C2H2 230 252 2.95e-3 SMART
ZnF_C2H2 258 280 4.79e-3 SMART
ZnF_C2H2 286 308 1.84e-4 SMART
ZnF_C2H2 314 336 6.32e-3 SMART
ZnF_C2H2 342 364 7.37e-4 SMART
ZnF_C2H2 370 392 1.6e-4 SMART
ZnF_C2H2 398 420 2.2e-2 SMART
ZnF_C2H2 426 448 6.78e-3 SMART
ZnF_C2H2 454 476 4.87e-4 SMART
ZnF_C2H2 482 504 2.24e-3 SMART
ZnF_C2H2 510 532 9.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229055
AA Change: P125L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably damaging
Transcript: ENSMUST00000229865
AA Change: P125L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 T C 8: 123,967,998 probably null Het
Abt1 T C 13: 23,422,055 E243G possibly damaging Het
Afap1l1 A G 18: 61,743,700 S361P probably damaging Het
Alms1 T C 6: 85,619,712 S507P probably benign Het
Atp13a3 A G 16: 30,362,700 V34A probably benign Het
Atpaf2 A T 11: 60,405,882 probably benign Het
Bbs1 A C 19: 4,892,994 L456R probably benign Het
Bri3bp G T 5: 125,452,153 G84* probably null Het
Bri3bp G C 5: 125,452,154 probably benign Het
Car10 A C 11: 93,490,613 H134P probably damaging Het
Cntrl A G 2: 35,116,679 E119G probably damaging Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Dirc2 T C 16: 35,730,306 T308A probably benign Het
Dppa4 T C 16: 48,291,108 V100A possibly damaging Het
Elmo1 G T 13: 20,290,383 E105* probably null Het
Esrp2 T G 8: 106,132,933 probably benign Het
Exoc3l4 A G 12: 111,422,401 K108R possibly damaging Het
Exph5 G A 9: 53,375,222 R1201H probably benign Het
Galnt3 A C 2: 66,084,156 probably benign Het
Gm14486 C T 2: 30,658,801 noncoding transcript Het
Gna12 T A 5: 140,760,962 I243F probably damaging Het
Itga5 A T 15: 103,356,785 W232R probably damaging Het
Lekr1 A T 3: 65,773,077 noncoding transcript Het
Lrp1 C T 10: 127,589,554 probably null Het
Mast4 T C 13: 102,735,640 M2215V probably benign Het
Mfap5 T C 6: 122,525,986 Y52H probably damaging Het
Mrps31 A G 8: 22,414,975 K127E possibly damaging Het
Mto1 C T 9: 78,461,029 T485M probably damaging Het
Mybbp1a G A 11: 72,442,431 C107Y probably damaging Het
Nedd4 G A 9: 72,730,850 probably benign Het
Nek2 A G 1: 191,829,485 E360G probably benign Het
Notch1 T A 2: 26,462,528 probably benign Het
Nubp1 T C 16: 10,420,186 probably benign Het
Pcdhb1 G A 18: 37,266,673 R559H possibly damaging Het
Pdcd11 G A 19: 47,129,263 V1684I probably benign Het
Pggt1b G T 18: 46,248,940 N258K probably benign Het
Pou6f1 C T 15: 100,586,120 V166M possibly damaging Het
Pprc1 A G 19: 46,063,672 D546G possibly damaging Het
Psapl1 T C 5: 36,204,307 V81A probably benign Het
Rin2 T A 2: 145,844,943 probably benign Het
Rpf1 A G 3: 146,506,544 F347S probably damaging Het
Rrp12 A T 19: 41,870,808 probably null Het
Ryr1 A T 7: 29,071,924 L2557Q probably null Het
Slc1a7 T C 4: 108,010,300 probably benign Het
Slc35e2 T A 4: 155,611,714 M186K possibly damaging Het
Snx6 G T 12: 54,770,764 S116* probably null Het
Sptan1 T C 2: 29,994,367 probably null Het
Sucla2 T A 14: 73,592,669 M382K probably damaging Het
Susd5 T C 9: 114,057,591 L16P possibly damaging Het
Tmem260 G A 14: 48,486,801 A369T possibly damaging Het
Tmprss6 A G 15: 78,452,522 Y393H probably damaging Het
Tnrc6c A T 11: 117,722,519 Q501L probably damaging Het
Trim17 A G 11: 58,965,543 Y142C probably damaging Het
Trim65 T C 11: 116,128,282 R144G probably damaging Het
Trpm1 A G 7: 64,223,799 T601A probably benign Het
Ttn A T 2: 76,734,344 V28483E probably damaging Het
Ube2l3 G T 16: 17,201,472 probably benign Het
Ube2l3 T C 16: 17,201,476 probably null Het
Yme1l1 T C 2: 23,195,306 probably benign Het
Zfat A G 15: 68,179,957 S663P probably benign Het
Other mutations in Zfp647
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:Zfp647 APN 15 76911670 nonsense probably null
IGL01680:Zfp647 APN 15 76917768 splice site probably benign
IGL02647:Zfp647 APN 15 76917715 missense probably damaging 1.00
IGL03213:Zfp647 APN 15 76911977 missense possibly damaging 0.46
IGL03401:Zfp647 APN 15 76911368 missense probably damaging 1.00
R0418:Zfp647 UTSW 15 76911386 missense probably damaging 1.00
R1479:Zfp647 UTSW 15 76911203 missense possibly damaging 0.94
R1913:Zfp647 UTSW 15 76911951 missense probably benign 0.02
R1959:Zfp647 UTSW 15 76911114 missense possibly damaging 0.57
R2176:Zfp647 UTSW 15 76911660 missense probably damaging 1.00
R3076:Zfp647 UTSW 15 76918009 start codon destroyed probably null
R3077:Zfp647 UTSW 15 76918009 start codon destroyed probably null
R3701:Zfp647 UTSW 15 76910910 missense probably damaging 1.00
R3702:Zfp647 UTSW 15 76910910 missense probably damaging 1.00
R3960:Zfp647 UTSW 15 76910976 unclassified probably null
R4938:Zfp647 UTSW 15 76911044 frame shift probably null
R4939:Zfp647 UTSW 15 76911044 frame shift probably null
R5196:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5197:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5345:Zfp647 UTSW 15 76911495 missense possibly damaging 0.48
R5415:Zfp647 UTSW 15 76911393 missense possibly damaging 0.79
R5791:Zfp647 UTSW 15 76918006 missense unknown
R5942:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5944:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5945:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5946:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6005:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6007:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6073:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6074:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6101:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6102:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6103:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6126:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6127:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6129:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6136:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6151:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6305:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6306:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6329:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6721:Zfp647 UTSW 15 76911876 missense probably benign 0.00
R7158:Zfp647 UTSW 15 76917305 missense probably benign 0.01
R7239:Zfp647 UTSW 15 76911756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTTCCACACTCAATGC -3'
(R):5'- ACTGTGAAGCAAAGCCAGC -3'

Sequencing Primer
(F):5'- CAGATATAGGGTCTCTCAACACTGG -3'
(R):5'- TTAAAGCAGCCCTTGTAGGTAGCC -3'
Posted On2017-03-31