Incidental Mutation 'R6056:Zfp335'
ID502025
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
MMRRC Submission 044223-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6056 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 164895098 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]
Predicted Effect probably null
Transcript: ENSMUST00000041361
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041643
SMART Domains Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849

DomainStartEndE-ValueType
WW 44 77 4.34e-4 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:PCIF1_WW 445 620 7.1e-74 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Meta Mutation Damage Score 0.5984 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 96% (99/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,942,878 W162R probably benign Het
2610507B11Rik C A 11: 78,271,384 L691I possibly damaging Het
4930438A08Rik C A 11: 58,293,638 P394H probably damaging Het
Aggf1 C T 13: 95,371,615 C81Y probably benign Het
Agxt2 A T 15: 10,378,877 D188V probably damaging Het
Angpt2 T C 8: 18,698,116 K376R probably benign Het
Anxa5 A G 3: 36,450,691 S241P probably damaging Het
Aox3 A T 1: 58,169,859 K850N probably damaging Het
Arid5a T C 1: 36,319,392 M415T probably benign Het
Aspa T A 11: 73,308,752 N233I probably damaging Het
Atp4b C T 8: 13,388,782 R198Q probably damaging Het
Atp8b2 A T 3: 89,946,221 V719E possibly damaging Het
Cacna1s T G 1: 136,105,836 V1017G probably damaging Het
Chrna4 G T 2: 181,029,442 Q174K probably damaging Het
Chrnb1 A T 11: 69,786,939 V329D probably damaging Het
Chst14 T C 2: 118,927,733 L336P probably damaging Het
Clec2e T C 6: 129,100,809 D22G probably benign Het
Csrnp2 A C 15: 100,482,382 S343A probably benign Het
Dapl1 C A 2: 59,484,713 A2E probably damaging Het
Dlec1 G T 9: 119,121,923 R519L probably damaging Het
Dmgdh T A 13: 93,708,743 F415I possibly damaging Het
Dmgdh T C 13: 93,752,326 V824A probably damaging Het
Dnah11 T G 12: 117,928,456 T3661P probably benign Het
Dnah3 A G 7: 120,030,031 F1434L probably damaging Het
Dnajc11 C A 4: 151,978,126 probably benign Het
Dot1l A G 10: 80,786,095 E527G probably damaging Het
Drc7 T C 8: 95,075,051 L680P probably damaging Het
Dysf T C 6: 84,106,862 Y742H probably benign Het
Ece1 A G 4: 137,961,647 Y665C probably damaging Het
Emc1 A G 4: 139,354,222 K54E possibly damaging Het
Enoph1 C T 5: 100,067,901 T247M probably damaging Het
Exoc2 T C 13: 30,900,829 K383R probably benign Het
Fam227b A T 2: 126,121,052 H181Q probably damaging Het
Fsip2 A T 2: 82,985,673 M3917L probably benign Het
Gtf3a T A 5: 146,955,528 probably benign Het
Hgfac T A 5: 35,041,629 C11* probably null Het
Hmcn1 C A 1: 150,663,909 A2944S probably damaging Het
Hps5 T A 7: 46,767,097 Y947F probably benign Het
Ighv2-5 A T 12: 113,685,500 I111K probably benign Het
Inpp5e A T 2: 26,407,848 L247* probably null Het
Kbtbd11 T C 8: 15,027,577 S59P probably benign Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kif1a T C 1: 93,024,648 D1303G probably damaging Het
Kif7 A G 7: 79,714,094 V22A possibly damaging Het
Lrit3 A T 3: 129,789,355 C328S probably damaging Het
Lrrc37a G T 11: 103,497,658 Q2314K unknown Het
Lurap1 G T 4: 116,137,402 P211T possibly damaging Het
Mbd2 T A 18: 70,580,803 N5K possibly damaging Het
Mbtps1 A C 8: 119,515,602 L894V probably benign Het
Mefv G A 16: 3,708,042 S787F possibly damaging Het
Miip T A 4: 147,862,335 I289F probably damaging Het
Mogat2 T A 7: 99,223,513 I155F possibly damaging Het
Mpp3 C A 11: 102,011,689 probably null Het
Mrrf A G 2: 36,177,221 K220E probably damaging Het
Mtmr6 C T 14: 60,298,170 P485L probably damaging Het
Mtor G A 4: 148,537,435 R1896K probably benign Het
Myh3 C T 11: 67,087,545 P453S probably benign Het
Nebl A G 2: 17,450,234 V112A probably benign Het
Nmnat2 G A 1: 153,074,734 W55* probably null Het
Nprl3 A G 11: 32,267,432 S37P probably damaging Het
Olfr1246 T C 2: 89,591,101 N5D possibly damaging Het
Oraov1 G T 7: 144,915,286 V17L possibly damaging Het
Pcdhga4 T G 18: 37,686,330 S311A probably benign Het
Pcdhgb6 T C 18: 37,743,112 V291A probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Peg3 T C 7: 6,709,571 E884G probably damaging Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Phf12 A G 11: 78,009,515 T146A probably benign Het
Polr3k C G 2: 181,864,488 N10K probably damaging Het
Prickle4 C A 17: 47,690,210 G144C probably damaging Het
Ptpn6 T C 6: 124,732,435 Y25C probably damaging Het
Rad1 A G 15: 10,488,074 I95V probably damaging Het
Rad23b A G 4: 55,382,540 T248A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rcc2 T G 4: 140,717,024 V342G possibly damaging Het
Rgs3 G T 4: 62,625,906 R136L probably damaging Het
Scube2 A T 7: 109,833,013 C399* probably null Het
Serpinb3d T C 1: 107,079,722 Y178C probably damaging Het
Slc1a7 A G 4: 108,012,261 T508A probably benign Het
Slc29a4 C T 5: 142,720,077 R439C probably damaging Het
Sntg2 A G 12: 30,312,561 I62T probably benign Het
Sowaha G A 11: 53,479,087 P274L probably damaging Het
Sptan1 A G 2: 29,996,782 N869S probably benign Het
Stx18 C A 5: 38,106,564 A64D probably damaging Het
Stxbp5 A G 10: 9,770,686 V94A probably benign Het
Sult1a1 T A 7: 126,676,452 probably null Het
Susd1 G T 4: 59,379,687 H313Q possibly damaging Het
Tdrd9 A T 12: 111,985,041 K88N probably damaging Het
Tlr5 A C 1: 182,974,038 R302S possibly damaging Het
Tnr C T 1: 159,886,909 T786I probably damaging Het
Tprgl A G 4: 154,160,095 S148P probably damaging Het
Trpc4ap T A 2: 155,671,074 N127I probably damaging Het
Tulp2 T A 7: 45,490,373 probably null Het
Uggt2 C T 14: 119,035,969 probably null Het
Ulk4 T A 9: 121,272,955 Y19F probably damaging Het
Upf1 T C 8: 70,333,037 Y1053C probably damaging Het
Vars2 A T 17: 35,665,788 H223Q probably benign Het
Vmn2r106 T A 17: 20,267,544 probably null Het
Ythdc2 T A 18: 44,840,210 F305I probably damaging Het
Zfp281 T C 1: 136,625,440 F52S possibly damaging Het
Zfp292 A T 4: 34,809,784 C1087S probably damaging Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAGCCATCTGCAGTCAAC -3'
(R):5'- TCCTATCAAGGGGAATGAGGGTC -3'

Posted On2018-02-19