Incidental Mutation 'FR4342:Zfp335'
ID511207
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #FR4342 ()
Quality Score217.468
Status Not validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GTCGTC to GTCGTCGTC at 164907465 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]
Predicted Effect probably benign
Transcript: ENSMUST00000041361
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129364
Predicted Effect probably benign
Transcript: ENSMUST00000139247
SMART Domains Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik TT TTATGT 8: 124,839,833 probably null Homo
4930402H24Rik TCC TCCCCC 2: 130,770,742 probably benign Het
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Homo
7530416G11Rik T A 15: 85,494,307 E45V unknown Homo
AF366264 G C 8: 13,837,613 H159Q probably benign Het
Ankrd35 TCCCC TCCC 3: 96,683,515 probably null Het
Anxa2 CCC CCCACC 9: 69,480,205 probably benign Het
Anxa2 C CCCA 9: 69,480,210 probably benign Het
Apc CAATAAAGC CAATAAAGCAAATAAAGC 18: 34,281,999 probably benign Homo
Arrb2 C T 11: 70,438,671 T269M probably damaging Homo
Bcas3 G A 11: 85,509,497 V431I probably benign Homo
Begain CCCCGCC CCCCGCCCCCGCC 12: 109,033,418 probably benign Homo
Catsper2 TCA TCAACA 2: 121,397,793 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Homo
Cd22 C T 7: 30,878,082 R2H possibly damaging Homo
Cluh GAGCCT GAGCCTCAGCCT 11: 74,669,524 probably benign Het
Cluh GCCTGA GCCTGAACCTGA 11: 74,669,526 probably benign Het
Cntnap1 AGCCCC AGCCCCCGCCCC 11: 101,189,575 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Col6a5 A T 9: 105,934,174 N715K unknown Homo
Cpeb4 T TGA 11: 31,927,638 probably benign Homo
D230025D16Rik G A 8: 105,241,098 G207E probably benign Homo
Dbr1 AGGAGG AGGAGGGGGAGG 9: 99,583,680 probably benign Het
Defa29 C G 8: 21,326,144 R69P probably benign Het
Dhx8 CG CGAGAACGG 11: 101,738,206 probably null Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Homo
Dthd1 C CTTA 5: 62,843,026 probably benign Homo
E4f1 GC GCCCC 17: 24,455,197 probably benign Het
F830016B08Rik A ACAG 18: 60,299,941 probably benign Homo
Fam166b CAGAG CAG 4: 43,427,384 probably null Homo
Fbrsl1 GTGTGTGTGCTGGTGCGTGTGCTGGTG GTGTGTGTGCTGGTGTGTGTGCTGGTGCGTGTGCTGGTG 5: 110,378,125 probably benign Het
Fbxo22 A C 9: 55,221,070 probably null Het
Flg G A 3: 93,290,513 probably benign Het
Fmn1 TCC TCCTCCACC 2: 113,525,783 probably benign Homo
Frmpd2 G T 14: 33,511,021 L399F probably damaging Homo
Gbp2b A G 3: 142,603,652 I175V probably benign Het
Gjc2 T TCCCG 11: 59,182,743 probably benign Homo
Gm13103 AA AATA 4: 143,851,643 probably null Homo
Gm14496 A C 2: 181,995,906 K258Q probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,066 probably benign Het
Gm4340 CAGAAG CAGAAGAAG 10: 104,196,099 probably benign Het
Gm7534 G GCTC 4: 134,202,631 probably benign Homo
Gpatch11 AGAGGA AGAGGATGAGGA 17: 78,842,178 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Homo
Hist1h1t TGTGG TG 13: 23,695,913 probably benign Homo
Hoxa3 G GCTT 6: 52,170,130 probably benign Homo
Ifi208 ATGGTG ATG 1: 173,677,698 probably benign Homo
Ighv5-9 C T 12: 113,661,877 S82N probably benign Homo
Klra10 G A 6: 130,272,747 R192C probably benign Het
Kmt2b TCCTCC TCCTCCCCCTCC 7: 30,586,375 probably benign Het
Krt10 CGCC CGCCGCC 11: 99,386,199 probably benign Het
Krt10 ACC ACCCCC 11: 99,386,203 probably benign Homo
Lce1m CGCTGCTGCTGCCACAGCA C 3: 93,018,247 probably benign Het
Mak16 T G,A 8: 31,161,749 E203D probably benign Homo
Med12l AGC AGCGGC 3: 59,275,988 probably benign Het
Med12l AGCGGC AGCGGCGGC 3: 59,275,994 probably benign Het
Mn1 AGC AGCGGC 5: 111,419,706 probably benign Het
Nacad TC TCAGGGGC 11: 6,599,762 probably benign Het
Naip1 C T 13: 100,425,471 R1062K probably benign Het
Ndel1 G A 11: 68,833,409 P246L probably damaging Het
Nelfe AC ACAAAGAGCGGGATCGAGACAGAGCC 17: 34,854,089 probably benign Het
Olfr495 A G 7: 108,395,893 T258A probably benign Het
Olfr495 G A 7: 108,395,898 M259I probably benign Het
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
P4ha2 GTGTTGCTG GTG 11: 54,110,251 probably benign Homo
Park2 G A 17: 11,854,763 V323M probably damaging Homo
Pde3b GGTGGTGGTG GGTGGTGGTGGTG 7: 114,534,775 probably benign Homo
Pdik1l ACCACC ACCACCCCCACC 4: 134,279,509 probably benign Homo
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Homo
Plekhs1 AGAC AGACCTCCCCCGCGAC 19: 56,479,861 probably benign Homo
Pramef25 G A 4: 143,949,742 T264M probably damaging Het
Pramef25 AAGAG AAG 4: 143,949,757 probably null Het
Ptms TCT TCTCCT 6: 124,914,454 probably benign Homo
Raet1d A G 10: 22,371,559 Q178R probably benign Het
Rtbdn AGCG AGCGCCGGCG 8: 84,956,168 probably benign Het
Rtbdn GC GCAGCGCC 8: 84,956,178 probably benign Het
Serac1 T A 17: 6,070,808 K70N probably damaging Homo
Sfswap CCCACTC CCCACTCAGACCACTC 5: 129,569,757 probably benign Homo
Sp110 ACT ACTGCT 1: 85,587,488 probably benign Het
Spaca1 GCTCTC GCTCTCACTCTC 4: 34,049,838 probably benign Het
Spag17 GGA GGATGA 3: 100,056,249 probably benign Het
Spag17 GGAGGAGGA GGAGGAGGAGGA 3: 100,056,252 probably benign Homo
Speer4a C A 5: 26,036,748 E127* probably null Het
Sry TGG TGGGGG Y: 2,662,835 probably benign Het
Sry GGT GGTTGT Y: 2,662,836 probably benign Het
Sry GGT GGTAGT Y: 2,662,839 probably benign Homo
Sry CTGCTGGTG CTG Y: 2,663,146 probably benign Het
Tdpoz3 C T 3: 93,826,512 P165S probably benign Het
Tdpoz4 GAA GA 3: 93,796,880 probably null Het
Tert AGGCC AGGCCAAGGGGGCC 13: 73,648,300 probably benign Homo
Tmbim7 C T 5: 3,670,064 R100C possibly damaging Homo
Tnfrsf9 CT CTGAT 4: 150,934,394 probably benign Homo
Tob1 AGC AGCCGC 11: 94,214,472 probably benign Het
Trav6n-5 GCTT G 14: 53,104,912 probably benign Homo
Triobp G GTCA 15: 78,993,392 probably benign Homo
Tsen2 AGG AGGTGG 6: 115,560,072 probably benign Het
Ubtf TCC TCCGCC 11: 102,306,956 probably benign Het
Ubtf TC TCCCC 11: 102,306,959 probably benign Het
Vmn2r125 G A 4: 156,350,965 V213I probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Homo
Zdhhc16 G A 19: 41,942,149 probably benign Het
Zfp28 G A 7: 6,394,863 G766R probably damaging Het
Zfp428 G A 7: 24,515,081 D41N probably damaging Homo
Zfp429 A T 13: 67,396,650 F48Y probably benign Het
Zfp598 CCACC CCACCCACACC 17: 24,680,780 probably benign Het
Zfp93 G A 7: 24,275,586 R332H possibly damaging Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GAGCATTGAGAAGTGCGTGTATC -3'
(R):5'- AAGATGTGCCAGTACCGGAG -3'

Sequencing Primer
(F):5'- AGAAGTGCGTGTATCTTTTCGC -3'
(R):5'- GTACCGGAGCAGCACCAAG -3'
Posted On2018-04-05