Incidental Mutation 'R6193:Vmn2r115'
ID502755
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Namevomeronasal 2, receptor 115
SynonymsEG638102
MMRRC Submission 044333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R6193 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23343977-23360128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23357009 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 527 (F527S)
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
Predicted Effect probably benign
Transcript: ENSMUST00000168175
AA Change: F527S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076
AA Change: F527S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A G 15: 60,920,780 I106T probably benign Het
Aagab A C 9: 63,617,513 N35H possibly damaging Het
Abcf1 A C 17: 35,963,572 N161K possibly damaging Het
Adam11 T A 11: 102,771,261 H140Q probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef26 A T 3: 62,339,792 D99V possibly damaging Het
Arhgef28 A G 13: 97,985,380 S559P probably damaging Het
C130060K24Rik T A 6: 65,456,158 F321I probably damaging Het
Capn11 A G 17: 45,653,504 probably null Het
Ccdc157 T C 11: 4,151,912 H3R probably damaging Het
Cd101 A G 3: 101,020,462 L101P probably damaging Het
Clca3a1 A G 3: 144,759,232 V80A possibly damaging Het
Cnot6 T A 11: 49,680,023 I381F probably benign Het
Cntn3 T A 6: 102,208,131 I675F probably benign Het
Cplx2 C T 13: 54,379,593 P97S probably damaging Het
Crtac1 T A 19: 42,323,797 E159V possibly damaging Het
Cyp27a1 A G 1: 74,737,072 I416V probably benign Het
Cyp2d37-ps T C 15: 82,689,813 noncoding transcript Het
Cyp2d9 A G 15: 82,452,527 T26A probably benign Het
Cyp2j7 T A 4: 96,195,203 R503S probably damaging Het
Dclk1 A T 3: 55,516,871 probably null Het
Dgkq A T 5: 108,655,500 C231* probably null Het
Dync1i1 T A 6: 5,730,679 M38K probably benign Het
Eif2ak4 C T 2: 118,400,600 probably benign Het
Ephx2 A T 14: 66,089,512 D411E probably benign Het
Ephx2 T G 14: 66,112,220 Q34P probably benign Het
Fam192a A G 8: 94,575,720 S228P probably damaging Het
Fer1l5 A T 1: 36,409,436 N1092Y probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fzd4 A T 7: 89,407,989 K415* probably null Het
Gfi1 A T 5: 107,721,531 Y278N probably benign Het
Gm11565 T C 11: 99,915,244 M154T probably benign Het
Gm14548 C G 7: 3,898,050 probably null Het
Gm7247 A G 14: 51,521,842 I93V possibly damaging Het
Golm1 T G 13: 59,645,158 I178L probably benign Het
Grip1 A T 10: 120,038,314 D302V probably damaging Het
Gtf2h1 G A 7: 46,806,830 probably null Het
Herc2 C A 7: 56,156,901 P2372T probably damaging Het
Ighv1-59 C A 12: 115,335,166 L89F probably damaging Het
Ighv7-4 G A 12: 114,222,825 A109V possibly damaging Het
Kcnk10 G T 12: 98,440,772 Q222K probably benign Het
Klra6 A T 6: 130,018,918 M159K probably benign Het
Lzts3 T C 2: 130,637,386 T36A probably damaging Het
Mgam T A 6: 40,747,920 Y443* probably null Het
Mmp23 T A 4: 155,651,533 M221L possibly damaging Het
Mmp7 T A 9: 7,695,518 V132E probably damaging Het
Npas2 C A 1: 39,292,762 T86N probably damaging Het
Olfr1043 C T 2: 86,162,284 V222M possibly damaging Het
Olfr392 T A 11: 73,814,824 H86L probably benign Het
Papola A T 12: 105,820,346 E103V probably benign Het
Parp9 A T 16: 35,947,551 N34Y possibly damaging Het
Pcdh7 A G 5: 57,720,324 D407G probably damaging Het
Pcdhb5 T G 18: 37,322,027 Y487D probably damaging Het
Pla2g4a T C 1: 149,902,430 D5G probably damaging Het
Plxnb1 T C 9: 109,104,903 L733P probably benign Het
Ppfia4 T C 1: 134,324,161 D425G probably benign Het
Prss2 T G 6: 41,521,820 I6S unknown Het
Qrich2 T A 11: 116,454,153 I1693L probably benign Het
Rad52 T C 6: 119,920,182 V324A probably benign Het
Rapgef2 A T 3: 79,069,444 Y1352N possibly damaging Het
Rsad2 T G 12: 26,456,187 Y78S probably damaging Het
Scaf1 A G 7: 45,006,780 probably benign Het
Sfxn5 T C 6: 85,269,936 T131A probably damaging Het
Slc4a10 T G 2: 62,243,357 probably null Het
Syt1 A G 10: 108,500,736 V357A probably benign Het
Tenm2 T A 11: 36,046,794 D1685V probably damaging Het
Thegl A G 5: 77,016,336 D62G possibly damaging Het
Tmc3 A G 7: 83,603,335 T315A probably benign Het
Tmem266 T C 9: 55,437,209 L375P probably benign Het
Tsks T G 7: 44,953,839 L355R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ube2f T A 1: 91,275,319 probably null Het
Usp37 A T 1: 74,492,928 V102D probably damaging Het
Usp44 G A 10: 93,847,148 probably benign Het
Zfp101 A C 17: 33,381,746 Y345* probably null Het
Zfp160 C A 17: 21,026,862 A558E probably benign Het
Zfp236 T C 18: 82,604,247 E1686G probably damaging Het
Zfp655 T A 5: 145,244,776 D481E probably benign Het
Zswim4 A G 8: 84,226,145 V396A probably benign Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23346206 missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23346176 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23359349 missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23346339 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346278 missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23346161 missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23359397 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346371 nonsense probably null
IGL00990:Vmn2r115 APN 17 23346372 missense probably benign 0.30
IGL00990:Vmn2r115 APN 17 23356960 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23346264 missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23359779 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23359824 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23348034 nonsense probably null
IGL01073:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23345139 missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23359283 missense probably damaging 0.97
R0023:Vmn2r115 UTSW 17 23346278 missense probably benign 0.14
R0197:Vmn2r115 UTSW 17 23359781 missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23345222 missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23360100 missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23346264 missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23359275 missense probably benign
R0865:Vmn2r115 UTSW 17 23346408 missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1145:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1146:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1207:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1266:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1318:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1367:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1420:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23345271 missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23346218 missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23359539 missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1678:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1716:Vmn2r115 UTSW 17 23347821 missense probably benign
R1846:Vmn2r115 UTSW 17 23359383 missense probably damaging 1.00
R1847:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1885:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1887:Vmn2r115 UTSW 17 23346033 missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23359414 missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23347953 missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23359323 missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23357024 missense possibly damaging 0.82
R3780:Vmn2r115 UTSW 17 23345172 missense probably damaging 1.00
R3806:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R3982:Vmn2r115 UTSW 17 23359974 missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23360043 missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23345103 missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23345223 missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23345880 missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23346399 missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23359851 missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23360056 missense probably damaging 1.00
R5613:Vmn2r115 UTSW 17 23345333 missense probably benign
R5821:Vmn2r115 UTSW 17 23347963 missense probably damaging 0.99
R6120:Vmn2r115 UTSW 17 23346029 missense probably damaging 1.00
R6213:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6290:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6319:Vmn2r115 UTSW 17 23347903 missense possibly damaging 0.70
R6495:Vmn2r115 UTSW 17 23359598 missense probably benign 0.02
R6599:Vmn2r115 UTSW 17 23346032 missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23346072 missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23346015 missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23359811 missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23359602 missense probably benign 0.01
R7353:Vmn2r115 UTSW 17 23345913 missense possibly damaging 0.65
V5622:Vmn2r115 UTSW 17 23346227 missense probably damaging 1.00
V5622:Vmn2r115 UTSW 17 23359359 missense probably benign
X0023:Vmn2r115 UTSW 17 23359988 small deletion probably benign
X0033:Vmn2r115 UTSW 17 23359988 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTGTCCTCATAAAATGCACTAGG -3'
(R):5'- TCCTATAATGACTAACTTGGGACAG -3'

Sequencing Primer
(F):5'- GCACTAGGTAAAAATCTGCTAACTC -3'
(R):5'- CTAACTTGGGACAGAGATGTATTTTG -3'
Posted On2018-02-27