Incidental Mutation 'R6495:Vmn2r115'
ID520475
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Namevomeronasal 2, receptor 115
SynonymsEG638102
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R6495 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location23343977-23360128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23359598 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 682 (I682F)
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
Predicted Effect probably benign
Transcript: ENSMUST00000168175
AA Change: I682F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076
AA Change: I682F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,773,714 E502V probably damaging Het
Apbb1ip T A 2: 22,853,120 Y321* probably null Het
Apob A G 12: 7,990,394 K577R probably null Het
Arfgef3 A G 10: 18,611,202 probably null Het
Asap3 T A 4: 136,228,479 probably null Het
Atp13a5 C T 16: 29,321,622 probably null Het
Bcan C A 3: 87,996,597 A194S possibly damaging Het
Cacybp T C 1: 160,208,523 T32A probably benign Het
Cd82 A G 2: 93,430,012 V90A probably benign Het
Chd5 C T 4: 152,367,372 R714C probably damaging Het
Cpb2 T C 14: 75,275,079 Y311H probably damaging Het
Cyp39a1 T C 17: 43,691,694 Y267H probably benign Het
Dnajc6 C T 4: 101,635,065 Q766* probably null Het
Dusp3 T C 11: 101,981,827 I48V probably benign Het
Eif3c A T 7: 126,547,500 F809I probably damaging Het
Exosc10 C T 4: 148,562,872 P213S probably benign Het
Galns C T 8: 122,600,610 G141D probably damaging Het
Gm3233 A T 10: 77,759,052 probably benign Het
Hadha A T 5: 30,120,050 L714H probably benign Het
Map3k20 T C 2: 72,368,419 M123T probably damaging Het
Nt5dc1 A G 10: 34,324,369 L217P probably damaging Het
Nubp2 A T 17: 24,885,603 D54E probably damaging Het
Olfr1471 T A 19: 13,445,625 D204E probably benign Het
Onecut1 C T 9: 74,863,215 R307C probably damaging Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pkd2 T A 5: 104,489,293 C591S probably damaging Het
Pramef20 T C 4: 144,376,839 N239S probably benign Het
Pwp2 A T 10: 78,177,127 V549E probably damaging Het
Rapsn A T 2: 91,036,628 S92C probably damaging Het
Rbm19 A G 5: 120,119,680 S90G probably damaging Het
Rfc1 G A 5: 65,273,815 probably null Het
Rims2 T A 15: 39,517,812 F1046L probably benign Het
S100a16 C T 3: 90,542,428 R73C probably benign Het
Shroom3 T C 5: 92,942,069 Y893H possibly damaging Het
Stt3b T A 9: 115,267,320 Y253F possibly damaging Het
Taar8b A G 10: 24,091,262 *345Q probably null Het
Tas2r119 G A 15: 32,177,530 V81I probably benign Het
Tas2r129 A G 6: 132,951,165 I22V probably benign Het
Tbc1d19 T G 5: 53,889,213 probably null Het
Tnip3 A T 6: 65,605,862 I218F probably benign Het
Tnks A T 8: 34,839,966 probably null Het
Ttc29 T C 8: 78,282,334 Y278H possibly damaging Het
Uba7 T A 9: 107,977,014 C214* probably null Het
Vmn2r75 A T 7: 86,164,079 M505K probably benign Het
Wdr19 A T 5: 65,258,123 T1313S probably benign Het
Zbtb22 A G 17: 33,917,250 D123G probably damaging Het
Zcchc6 T C 13: 59,799,939 E454G possibly damaging Het
Zdhhc7 A G 8: 120,086,656 I138T probably benign Het
Zfp706 T C 15: 37,003,801 K7R unknown Het
Zkscan3 G A 13: 21,387,905 P519L probably damaging Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23346206 missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23346176 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23359349 missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23346339 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346278 missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23346161 missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23359397 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346371 nonsense probably null
IGL00990:Vmn2r115 APN 17 23346372 missense probably benign 0.30
IGL00990:Vmn2r115 APN 17 23356960 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23346264 missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23359779 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23359824 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23348034 nonsense probably null
IGL01073:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23345139 missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23359283 missense probably damaging 0.97
R0023:Vmn2r115 UTSW 17 23346278 missense probably benign 0.14
R0197:Vmn2r115 UTSW 17 23359781 missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23345222 missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23360100 missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23346264 missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23359275 missense probably benign
R0865:Vmn2r115 UTSW 17 23346408 missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1145:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1146:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1207:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1266:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1318:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1367:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1420:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23345271 missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23346218 missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23359539 missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1678:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1716:Vmn2r115 UTSW 17 23347821 missense probably benign
R1846:Vmn2r115 UTSW 17 23359383 missense probably damaging 1.00
R1847:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1885:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1887:Vmn2r115 UTSW 17 23346033 missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23359414 missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23347953 missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23359323 missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23357024 missense possibly damaging 0.82
R3780:Vmn2r115 UTSW 17 23345172 missense probably damaging 1.00
R3806:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R3982:Vmn2r115 UTSW 17 23359974 missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23360043 missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23345103 missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23345223 missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23345880 missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23346399 missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23359851 missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23360056 missense probably damaging 1.00
R5613:Vmn2r115 UTSW 17 23345333 missense probably benign
R5821:Vmn2r115 UTSW 17 23347963 missense probably damaging 0.99
R6120:Vmn2r115 UTSW 17 23346029 missense probably damaging 1.00
R6193:Vmn2r115 UTSW 17 23357009 missense probably benign 0.01
R6213:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6290:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6319:Vmn2r115 UTSW 17 23347903 missense possibly damaging 0.70
R6599:Vmn2r115 UTSW 17 23346032 missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23346072 missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23346015 missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23359811 missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23359602 missense probably benign 0.01
V5622:Vmn2r115 UTSW 17 23346227 missense probably damaging 1.00
V5622:Vmn2r115 UTSW 17 23359359 missense probably benign
X0023:Vmn2r115 UTSW 17 23359988 small deletion probably benign
X0033:Vmn2r115 UTSW 17 23359988 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTTGGGGTCATTGTGAAGCAC -3'
(R):5'- CAATGATGATCTGTCCATGCTC -3'

Sequencing Primer
(F):5'- ACAGTACTCCAGTTGTTAAGGCC -3'
(R):5'- ATGATCTGTCCATGCTCAGATTG -3'
Posted On2018-06-06