Incidental Mutation 'R6281:Olfr508'
ID507958
Institutional Source Beutler Lab
Gene Symbol Olfr508
Ensembl Gene ENSMUSG00000063764
Gene Nameolfactory receptor 508
SynonymsMOR204-6, GA_x6K02T2PBJ9-10959726-10960658
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108629994-108631628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 108630402 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 137 (S137A)
Ref Sequence ENSEMBL: ENSMUSP00000072686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072914]
Predicted Effect probably benign
Transcript: ENSMUST00000072914
AA Change: S137A

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072686
Gene: ENSMUSG00000063764
AA Change: S137A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.8e-50 PFAM
Pfam:7tm_1 41 290 3.8e-20 PFAM
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Zfyve27 T A 19: 42,182,755 N127K probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Olfr508
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Olfr508 APN 7 108630678 missense probably benign 0.01
IGL02045:Olfr508 APN 7 108630532 missense probably damaging 1.00
IGL03354:Olfr508 APN 7 108630528 missense possibly damaging 0.75
R0047:Olfr508 UTSW 7 108630552 missense probably benign 0.00
R1162:Olfr508 UTSW 7 108630913 missense probably benign 0.00
R1816:Olfr508 UTSW 7 108630157 missense probably damaging 1.00
R1828:Olfr508 UTSW 7 108630648 missense possibly damaging 0.88
R1924:Olfr508 UTSW 7 108630355 missense probably damaging 1.00
R1938:Olfr508 UTSW 7 108630838 missense probably benign 0.42
R2155:Olfr508 UTSW 7 108630777 missense probably damaging 1.00
R3416:Olfr508 UTSW 7 108630018 missense possibly damaging 0.75
R4078:Olfr508 UTSW 7 108630907 missense probably benign 0.31
R4271:Olfr508 UTSW 7 108630353 nonsense probably null
R4884:Olfr508 UTSW 7 108630612 missense probably damaging 0.98
R5842:Olfr508 UTSW 7 108630652 missense probably benign 0.06
R6558:Olfr508 UTSW 7 108630188 missense probably damaging 0.99
R6828:Olfr508 UTSW 7 108630293 missense possibly damaging 0.48
R7498:Olfr508 UTSW 7 108630416 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTCACACCCATCATGCTG -3'
(R):5'- GACCACAATGATCGACCCTG -3'

Sequencing Primer
(F):5'- CATCATGCTGAAGGGCTTTCTCAG -3'
(R):5'- TCGACCCTGAAGAGATTGCTG -3'
Posted On2018-03-15