Incidental Mutation 'R6281:Zfyve27'
ID507979
Institutional Source Beutler Lab
Gene Symbol Zfyve27
Ensembl Gene ENSMUSG00000018820
Gene Namezinc finger, FYVE domain containing 27
Synonymsprotrudin, 2210011N02Rik, 9530077C24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6281 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location42163951-42194590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42182755 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 127 (N127K)
Ref Sequence ENSEMBL: ENSMUSP00000129561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099443] [ENSMUST00000168130] [ENSMUST00000169536]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099443
AA Change: N221K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097042
Gene: ENSMUSG00000018820
AA Change: N221K

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
FYVE 335 408 2.52e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165783
Predicted Effect probably damaging
Transcript: ENSMUST00000168130
AA Change: N127K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129561
Gene: ENSMUSG00000018820
AA Change: N127K

DomainStartEndE-ValueType
transmembrane domain 96 118 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169536
AA Change: N221K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130684
Gene: ENSMUSG00000018820
AA Change: N221K

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
FYVE 342 415 2.52e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170184
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with several transmembrane domains, a Rab11-binding domain and a lipid-binding FYVE finger domain. The encoded protein appears to promote neurite formation. A mutation in this gene has been reported to be associated with hereditary spastic paraplegia, however the pathogenicity of the mutation, which may simply represent a polymorphism, is unclear. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik C A 8: 121,531,881 C166F probably damaging Het
Aida C T 1: 183,322,290 A237V probably damaging Het
Ankib1 T C 5: 3,701,965 T692A possibly damaging Het
As3mt T C 19: 46,724,923 V303A possibly damaging Het
Bhlhe40 T A 6: 108,664,462 probably null Het
Bhmt2 G A 13: 93,663,160 P256L probably damaging Het
Bpifb1 T C 2: 154,206,465 I140T probably damaging Het
Cat A T 2: 103,471,769 H194Q probably damaging Het
Cbfa2t3 C A 8: 122,633,409 R466L probably damaging Het
Fancm T C 12: 65,088,270 V279A probably damaging Het
Gabra2 T C 5: 71,034,762 T75A probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm3512 T A 14: 7,159,254 D7V possibly damaging Het
Gpr15 A G 16: 58,718,594 F44S probably damaging Het
Ighv1-72 C A 12: 115,758,403 C5F probably benign Het
Lilra6 A G 7: 3,911,973 L474P probably damaging Het
Mboat2 T C 12: 24,957,679 V297A probably benign Het
Muc2 C G 7: 141,752,403 C276W probably damaging Het
Ncor1 T C 11: 62,373,545 S141G possibly damaging Het
Olfr1283 T C 2: 111,369,549 *306R probably null Het
Olfr508 T G 7: 108,630,402 S137A probably benign Het
Pax5 T G 4: 44,691,955 E97A probably benign Het
Pcdhga11 A T 18: 37,757,373 D478V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf21b G T 15: 84,854,745 D38E probably benign Het
Ptcd1 T C 5: 145,165,071 K146R probably benign Het
Rad23a A T 8: 84,838,110 M166K probably damaging Het
Rfc4 A T 16: 23,118,066 probably null Het
Slc17a3 T A 13: 23,856,799 I336N probably benign Het
Slc2a12 T A 10: 22,665,320 M358K probably damaging Het
Stk31 T G 6: 49,469,180 M939R possibly damaging Het
Tecrl T A 5: 83,294,606 T167S probably damaging Het
Tfap2d G C 1: 19,104,478 G52R probably benign Het
Ttn C T 2: 76,941,828 V2577M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vezt G A 10: 93,973,946 R578C probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vwa3b T A 1: 37,123,982 L562Q probably damaging Het
Znfx1 A G 2: 167,055,885 F373S probably damaging Het
Zswim8 G A 14: 20,714,640 V693I probably benign Het
Other mutations in Zfyve27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Zfyve27 APN 19 42183433 missense probably benign
IGL02040:Zfyve27 APN 19 42179391 missense probably damaging 1.00
IGL02048:Zfyve27 APN 19 42185857 missense probably damaging 0.99
IGL02135:Zfyve27 APN 19 42184136 missense probably damaging 1.00
ignored UTSW 19 42171731 missense probably benign 0.01
overlooked UTSW 19 42182657 critical splice acceptor site probably null
R0388:Zfyve27 UTSW 19 42189585 missense probably damaging 1.00
R1589:Zfyve27 UTSW 19 42171745 critical splice donor site probably null
R1908:Zfyve27 UTSW 19 42171548 start codon destroyed probably null 1.00
R2151:Zfyve27 UTSW 19 42171731 missense probably benign 0.01
R2204:Zfyve27 UTSW 19 42183446 missense probably damaging 1.00
R2205:Zfyve27 UTSW 19 42183446 missense probably damaging 1.00
R5800:Zfyve27 UTSW 19 42182663 missense probably damaging 1.00
R5819:Zfyve27 UTSW 19 42183496 missense probably benign 0.00
R5870:Zfyve27 UTSW 19 42171671 missense probably benign 0.01
R5959:Zfyve27 UTSW 19 42179448 missense unknown
R6217:Zfyve27 UTSW 19 42189577 missense probably damaging 1.00
R6337:Zfyve27 UTSW 19 42182657 critical splice acceptor site probably null
R6638:Zfyve27 UTSW 19 42181497 splice site probably null
R7438:Zfyve27 UTSW 19 42189520 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGTTCACCCAGGTTCTATGG -3'
(R):5'- AGCCACCTTAGAGGACTGTC -3'

Sequencing Primer
(F):5'- ACCCAGGTTCTATGGCGCTC -3'
(R):5'- ACCTTAGAGGACTGTCAGCCC -3'
Posted On2018-03-15