Incidental Mutation 'R6418:Frem3'
ID518075
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6418 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80611152 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 25 (T25A)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably benign
Transcript: ENSMUST00000039695
AA Change: T25A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: T25A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930507D05Rik C T 10: 62,449,662 A55V unknown Het
Adra1b T G 11: 43,776,201 D403A probably benign Het
Ankdd1b A T 13: 96,460,897 L9Q probably damaging Het
Ankrd17 A T 5: 90,278,345 S789R possibly damaging Het
B3galnt1 A G 3: 69,574,993 S312P probably damaging Het
C4bp C T 1: 130,656,013 V73M probably damaging Het
Cenpe T A 3: 135,251,544 N1854K probably damaging Het
Chrm2 A C 6: 36,523,739 Y177S probably damaging Het
Clca4b C T 3: 144,928,235 V140I probably benign Het
Csad A G 15: 102,179,523 S322P probably damaging Het
Depdc1b T G 13: 108,357,422 Y115D probably damaging Het
Dnah17 T C 11: 118,129,197 Y8C probably damaging Het
Dsg3 T C 18: 20,523,760 probably null Het
E330021D16Rik C A 6: 136,401,101 D244Y probably damaging Het
Elf5 A G 2: 103,439,352 T93A possibly damaging Het
Eogt C T 6: 97,145,392 D27N possibly damaging Het
Fam118b T C 9: 35,235,337 D78G probably damaging Het
Fam160b1 T A 19: 57,381,734 M470K probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gm6588 T C 5: 112,450,153 S189P probably benign Het
Golm1 T C 13: 59,665,561 Y32C probably damaging Het
Has1 A T 17: 17,849,945 V238E probably damaging Het
Hkdc1 T C 10: 62,383,804 R907G possibly damaging Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Krtap24-1 C T 16: 88,611,873 V122I probably damaging Het
Lrrc10 T G 10: 117,045,711 L97V probably damaging Het
Map3k20 T A 2: 72,402,113 M371K probably benign Het
Mis18bp1 A T 12: 65,158,543 M2K possibly damaging Het
Mob3b T A 4: 34,954,049 probably null Het
Muc4 A G 16: 32,751,789 T556A possibly damaging Het
Muc6 A C 7: 141,639,610 probably benign Het
Ncapg A T 5: 45,681,816 L519F probably damaging Het
Nfix A G 8: 84,727,149 S265P probably benign Het
Olfr1226 T C 2: 89,193,479 K185R probably damaging Het
Olfr1299 T C 2: 111,664,472 V82A probably benign Het
Olfr62 T A 4: 118,665,611 F31L possibly damaging Het
Olfr678 T C 7: 105,070,307 L280P probably damaging Het
Olfr955 C A 9: 39,469,816 K303N probably benign Het
Osgin2 T C 4: 16,006,410 T95A probably benign Het
Parp4 T C 14: 56,620,651 probably null Het
Pcdh7 G A 5: 57,721,704 G867D probably damaging Het
Pcdhb22 T C 18: 37,519,906 S476P possibly damaging Het
Phldb1 A G 9: 44,711,900 I619T probably damaging Het
Ppp1r13l C T 7: 19,371,331 R343C probably damaging Het
Rab2b T A 14: 52,268,707 probably benign Het
Rims2 A T 15: 39,509,696 E972V probably damaging Het
Slc26a9 G T 1: 131,758,490 C337F probably benign Het
Spty2d1 A G 7: 46,998,003 S393P probably damaging Het
Stkld1 A T 2: 26,941,081 N90I possibly damaging Het
Svep1 T A 4: 58,053,126 R3406S probably benign Het
Svil A T 18: 5,040,171 D48V probably benign Het
Thsd7a T A 6: 12,555,082 K268* probably null Het
Tmc6 A G 11: 117,770,500 L618P probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Ubn1 A G 16: 5,081,927 H1101R probably benign Het
Upf2 G A 2: 6,027,339 V899I unknown Het
Ush2a A T 1: 188,628,566 N2161I probably damaging Het
Usp25 A T 16: 77,062,442 D276V probably damaging Het
Vmn2r68 T A 7: 85,233,707 H279L probably benign Het
Vps13d G A 4: 145,092,280 R3019W probably damaging Het
Vsig10 A T 5: 117,348,296 E423D probably benign Het
Wdfy2 T A 14: 62,925,133 F95I probably benign Het
Xrn1 A G 9: 96,033,710 probably null Het
Zdhhc13 A G 7: 48,811,401 T362A possibly damaging Het
Zfp984 C T 4: 147,761,246 S2N probably benign Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGAGAGCTTGTCCGTTGCTG -3'
(R):5'- GAATCACTAGATCCCGCAGTG -3'

Sequencing Primer
(F):5'- AGTTGCTGCAGCTCCTGGATC -3'
(R):5'- CCGCAGTGGGTTAAGCCAAAC -3'
Posted On2018-05-24