Incidental Mutation 'R0834:Frem3'
ID77731
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission 039013-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0834 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80687008 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1966 (Y1966C)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: Y1966C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: Y1966C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Meta Mutation Damage Score 0.47 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T C 16: 14,093,931 L47P probably damaging Het
Add2 A T 6: 86,086,917 E66V probably damaging Het
Aldh1a3 T C 7: 66,412,910 I156V probably benign Het
Ang4 T A 14: 51,764,268 K74N probably benign Het
Arcn1 A T 9: 44,758,875 probably benign Het
Arhgef33 T A 17: 80,347,597 probably benign Het
Arntl2 A G 6: 146,822,687 H359R probably damaging Het
Atn1 A G 6: 124,743,225 probably benign Het
Brip1 T C 11: 86,192,827 T123A probably benign Het
Camkv A G 9: 107,945,846 Y95C probably damaging Het
Cdk12 T A 11: 98,204,385 S340T probably benign Het
Ckap2l G A 2: 129,296,304 probably benign Het
Clmn A T 12: 104,771,826 L1042Q probably damaging Het
Clmn G T 12: 104,771,827 L1042M probably damaging Het
Cluh T C 11: 74,663,805 V737A probably benign Het
Cpne8 A G 15: 90,540,259 V309A probably benign Het
Cpxm2 T A 7: 132,154,613 probably benign Het
Csmd3 A T 15: 47,883,677 probably benign Het
Ctr9 T A 7: 111,050,952 S818T probably benign Het
Cyp26a1 C T 19: 37,699,957 A309V probably damaging Het
D10Jhu81e T C 10: 78,162,705 D229G probably damaging Het
Dbndd2 C T 2: 164,490,202 T115I possibly damaging Het
Ddx58 T A 4: 40,239,596 E34V possibly damaging Het
Dhcr7 A G 7: 143,841,227 N157S probably benign Het
Dlx2 C A 2: 71,545,515 V155F probably damaging Het
Duox1 A T 2: 122,346,501 I1470F probably damaging Het
Esrrb A T 12: 86,470,297 I68F probably benign Het
Fhod3 T A 18: 25,115,805 L1347* probably null Het
Fip1l1 T C 5: 74,595,060 probably benign Het
Ggt5 C T 10: 75,604,770 R242C possibly damaging Het
Gm14496 G A 2: 181,995,687 V185I probably benign Het
Gnptab T C 10: 88,429,952 V409A probably damaging Het
Gramd1a A G 7: 31,138,164 F390S possibly damaging Het
Helz2 A G 2: 181,230,777 S2477P probably damaging Het
Hsd17b3 T C 13: 64,089,122 K3E probably benign Het
Ift172 T C 5: 31,257,371 H1395R probably benign Het
Jam2 T A 16: 84,812,967 C180S probably damaging Het
Kalrn A C 16: 34,049,919 S160A possibly damaging Het
Kcnk3 T C 5: 30,622,635 I343T probably damaging Het
Kif13a T C 13: 46,814,236 E334G probably damaging Het
Klhl41 A G 2: 69,678,147 K482E possibly damaging Het
Lig3 A G 11: 82,798,287 E794G probably damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Ndst2 A G 14: 20,729,693 Y160H probably damaging Het
Ndufb10 T C 17: 24,722,674 M90V probably damaging Het
Obscn T C 11: 59,133,278 K522R probably benign Het
Olfml2b T C 1: 170,647,844 S113P probably benign Het
Olfr1251 A G 2: 89,667,079 I269T probably benign Het
Olfr1424 T A 19: 12,059,615 M46L probably benign Het
Olfr298 T A 7: 86,489,490 E20D probably benign Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr620 T C 7: 103,612,237 T39A probably benign Het
Parg T C 14: 32,214,554 probably benign Het
Pde7a C T 3: 19,230,318 C367Y probably damaging Het
Pigr T A 1: 130,844,544 C166* probably null Het
Pip4k2c A T 10: 127,200,835 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkd2 A T 7: 16,865,677 probably benign Het
Ptprt G T 2: 161,812,139 probably null Het
Rapgef5 C T 12: 117,647,121 probably benign Het
Retreg1 T C 15: 25,971,670 L356P probably benign Het
Rnf43 A G 11: 87,731,251 T393A probably benign Het
Samd3 T C 10: 26,271,827 S467P probably benign Het
Scarf1 C A 11: 75,514,403 C89* probably null Het
Sdk1 T C 5: 141,242,024 L59S probably benign Het
Sgca C T 11: 94,970,686 W244* probably null Het
Sh3d21 T C 4: 126,151,272 K538R probably benign Het
Smyd4 T A 11: 75,391,132 L477Q possibly damaging Het
Sra1 A G 18: 36,668,776 M87T probably benign Het
Ssh2 T C 11: 77,437,633 Y336H possibly damaging Het
Steap1 T C 5: 5,740,357 Y197C probably damaging Het
Strn3 A G 12: 51,627,096 probably benign Het
Tgm3 A G 2: 130,026,757 T205A probably benign Het
Tll2 G A 19: 41,113,073 T374I probably damaging Het
Tmem63b C A 17: 45,660,944 D782Y possibly damaging Het
Trim10 G A 17: 36,872,391 S193N probably benign Het
Ttf1 A T 2: 29,073,950 K613* probably null Het
Tube1 T A 10: 39,134,172 probably null Het
Uimc1 T A 13: 55,076,409 probably null Het
Wwp2 G T 8: 107,556,796 probably benign Het
Zfp101 C T 17: 33,382,444 V113I probably benign Het
Zfp292 T C 4: 34,809,114 D1310G probably benign Het
Zfp575 A T 7: 24,585,820 L132H probably damaging Het
Zmym2 T C 14: 56,956,963 F1226S probably damaging Het
Zswim6 A C 13: 107,726,454 noncoding transcript Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTTTGGAAGCCTGCCAACTGC -3'
(R):5'- GCTATCACAAAGAAGCTGAATCGTTGC -3'

Sequencing Primer
(F):5'- agttttgactgcgctttcc -3'
(R):5'- GAAGCTGAATCGTTGCTTAGAG -3'
Posted On2013-10-16