Incidental Mutation 'R6404:Plxnb1'
ID518900
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6404 (G1)
Quality Score177.009
Status Validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109116637 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2079 (I2079F)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093]
Predicted Effect probably damaging
Transcript: ENSMUST00000072093
AA Change: I2079F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: I2079F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 98% (40/41)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,265,918 D1540G probably benign Het
Adamts7 A T 9: 90,180,456 probably null Het
Apol10a C A 15: 77,489,041 F292L probably benign Het
Atp13a4 A T 16: 29,471,901 Y243* probably null Het
Cc2d2a A G 5: 43,704,074 N660D possibly damaging Het
Ccdc57 T C 11: 120,894,712 T466A probably benign Het
Ccdc74a A T 16: 17,650,025 N249Y possibly damaging Het
Cd3e T A 9: 45,001,128 E106V probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Csmd2 T C 4: 128,521,950 Y2691H possibly damaging Het
Dmxl2 T C 9: 54,375,536 R2786G probably damaging Het
Dpyd A G 3: 119,265,957 T768A probably benign Het
Endou T A 15: 97,712,131 Q428L probably damaging Het
Fam13c T C 10: 70,448,816 probably null Het
Fam160a2 G A 7: 105,384,991 R478* probably null Het
Frmd5 G A 2: 121,549,218 R70* probably null Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Gm4131 T A 14: 62,481,149 R3* probably null Het
Habp4 A G 13: 64,182,186 T302A possibly damaging Het
Ift81 A T 5: 122,611,006 D27E probably damaging Het
Iqcf3 T C 9: 106,552,884 I107V probably benign Het
Iqgap2 A G 13: 95,729,477 I298T probably benign Het
Lilr4b A G 10: 51,485,729 D199G probably damaging Het
Lsm8 C T 6: 18,848,740 S3F possibly damaging Het
Meox1 T C 11: 101,878,656 E238G probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T C 2: 52,207,725 Y901C probably damaging Het
Nfat5 A G 8: 107,370,588 M121V probably benign Het
Notch2 G A 3: 98,081,998 G278D probably damaging Het
Olfr1226 T C 2: 89,193,562 I157M probably damaging Het
Pbld2 T A 10: 63,054,328 S172T probably damaging Het
Pla2g7 T A 17: 43,594,797 Y83N probably damaging Het
Rara T C 11: 98,961,013 F17L probably benign Het
Skint5 G A 4: 113,942,609 T121I probably damaging Het
Slco6c1 T C 1: 97,118,605 Y251C probably damaging Het
Slmap T A 14: 26,422,411 probably null Het
Uba2 A T 7: 34,154,560 L319Q probably damaging Het
Vmn2r96 A T 17: 18,597,531 I457F probably damaging Het
Zfp57 A T 17: 37,009,824 H190L probably damaging Het
Zfp738 A G 13: 67,671,060 S271P possibly damaging Het
Zp2 A T 7: 120,135,542 H474Q possibly damaging Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 109112307 missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 109100385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCATGCTTTGCCTTGGG -3'
(R):5'- TACCGTCTCCAGATCCTGAC -3'

Sequencing Primer
(F):5'- GCTCTGTTCCCACTGCAGG -3'
(R):5'- GATCCTGACAGATTCTCCAGATG -3'
Posted On2018-05-24