Incidental Mutation 'R6661:Plxnb1'
ID526847
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6661 (G1)
Quality Score221.009
Status Validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109104299 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 666 (C666R)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093] [ENSMUST00000130366] [ENSMUST00000131462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072093
AA Change: C666R

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: C666R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130366
SMART Domains Protein: ENSMUSP00000114358
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131462
SMART Domains Protein: ENSMUSP00000115265
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192117
Predicted Effect probably benign
Transcript: ENSMUST00000192988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195364
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.8%
Validation Efficiency 93% (38/41)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,464 H741Q possibly damaging Het
Amy2a1 T C 3: 113,531,714 Y77C probably damaging Het
Ankrd9 C A 12: 110,977,768 probably benign Het
Arhgap28 C A 17: 67,845,751 W675L probably damaging Het
Arhgap44 A G 11: 65,010,008 S595P probably damaging Het
Cacna1d C A 14: 30,089,875 D1273Y probably damaging Het
Ccr4 T C 9: 114,495,963 probably benign Het
Celsr1 A G 15: 85,918,934 V2468A probably damaging Het
Chd2 T C 7: 73,490,482 E666G possibly damaging Het
Ctnnd1 C A 2: 84,609,642 V775L probably damaging Het
Cux2 C A 5: 121,869,297 R767L probably benign Het
Decr2 A G 17: 26,083,587 L217S possibly damaging Het
Dennd4c T A 4: 86,799,389 M541K possibly damaging Het
Dnah7a T C 1: 53,623,450 R651G probably benign Het
Fbrsl1 A T 5: 110,378,097 F80I probably damaging Het
Fmnl2 C A 2: 53,108,285 P554Q probably damaging Het
Gapvd1 C T 2: 34,728,438 D308N probably damaging Het
Gatb A G 3: 85,652,419 probably null Het
Jcad G A 18: 4,675,256 G1006D probably damaging Het
Krt2 A G 15: 101,815,963 Y289H probably damaging Het
Lrrc52 A G 1: 167,466,353 F121S probably damaging Het
Lrrc63 G A 14: 75,125,193 T299I unknown Het
Magi1 T C 6: 93,943,308 N109S probably benign Het
Mbd4 C A 6: 115,849,155 E271* probably null Het
Meis2 T A 2: 115,864,270 D457V probably damaging Het
Mroh8 A G 2: 157,225,627 V604A probably benign Het
Nedd4 T A 9: 72,686,095 V150E probably damaging Het
Nes A G 3: 87,976,936 E790G probably damaging Het
Olfr1098 T C 2: 86,923,148 N128S probably benign Het
Pik3c2a T C 7: 116,368,758 I834V possibly damaging Het
Prg2 T C 2: 84,983,276 probably null Het
Selenbp2 A G 3: 94,702,514 D257G probably damaging Het
Slf1 T C 13: 77,043,845 R957G probably damaging Het
Smim10l1 T A 6: 133,105,550 M46K possibly damaging Het
Sptbn5 T C 2: 120,072,375 Y50C possibly damaging Het
Tcea1 A G 1: 4,858,429 probably benign Het
Tex14 A G 11: 87,495,016 E234G probably damaging Het
Tmbim4 T C 10: 120,224,651 V181A probably benign Het
Trappc9 A G 15: 72,590,144 S1091P possibly damaging Het
Txnrd3 T A 6: 89,654,152 C143* probably null Het
Ushbp1 C T 8: 71,390,661 C314Y unknown Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 109112307 missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 109100385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTCTATGACTGCGTGGC -3'
(R):5'- AAGCAGCCATTCTCCAGTG -3'

Sequencing Primer
(F):5'- AGTTACTGCGTCTTCCCCATCTG -3'
(R):5'- GACTCTGTCACACAAAGCAGCTG -3'
Posted On2018-07-23