Incidental Mutation 'R6761:Ap3m1'
ID531714
Institutional Source Beutler Lab
Gene Symbol Ap3m1
Ensembl Gene ENSMUSG00000021824
Gene Nameadaptor-related protein complex 3, mu 1 subunit
SynonymsC78982, 1200013D09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6761 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location21031442-21052508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21038028 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 107 (M107V)
Ref Sequence ENSEMBL: ENSMUSP00000153649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022369] [ENSMUST00000022371] [ENSMUST00000126536] [ENSMUST00000130291] [ENSMUST00000154460] [ENSMUST00000224016]
Predicted Effect probably benign
Transcript: ENSMUST00000022369
SMART Domains Protein: ENSMUSP00000022369
Gene: ENSMUSG00000021823

DomainStartEndE-ValueType
Pfam:Vinculin 3 485 9e-203 PFAM
Pfam:Vinculin 475 1066 1.7e-301 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022371
AA Change: M267V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022371
Gene: ENSMUSG00000021824
AA Change: M267V

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 96 1e-23 SMART
Pfam:Adap_comp_sub 111 364 9.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126536
SMART Domains Protein: ENSMUSP00000116046
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 91 9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130291
SMART Domains Protein: ENSMUSP00000118259
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 138 9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154460
AA Change: M321V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117346
Gene: ENSMUSG00000021824
AA Change: M321V

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 136 1.8e-8 PFAM
Pfam:Adap_comp_sub 165 418 1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224016
AA Change: M107V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the medium subunit of AP-3, which is an adaptor-related protein complex associated with the Golgi region as well as more peripheral intracellular structures. AP-3 facilitates the budding of vesicles from the Golgi membrane, and it may directly function in protein sorting to the endosomal/lysosomal system. AP-3 is a heterotetrameric protein complex composed of two large subunits (delta and beta3), a medium subunit (mu3), and a small subunit (sigma 3). Mutations in one of the large subunits of AP-3 have been associated with the Hermansky-Pudlak syndrome, a genetic disorder characterized by defective lysosome-related organelles. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T C 17: 35,567,948 V61A probably benign Het
Actr3b C T 5: 25,825,139 S67F probably damaging Het
Ccdc27 C T 4: 154,037,698 G241D unknown Het
Cit T G 5: 115,908,675 D382E probably damaging Het
Clec3b G T 9: 123,156,939 G134V probably damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Dst T C 1: 34,214,550 S4300P probably damaging Het
Ebna1bp2 C T 4: 118,623,361 R134* probably null Het
Efcab14 T C 4: 115,738,827 S57P probably damaging Het
Exosc2 T C 2: 31,670,863 probably null Het
Fam213a T A 14: 40,994,621 H198L probably damaging Het
Hfm1 T C 5: 106,895,279 T630A probably damaging Het
Hkdc1 A T 10: 62,408,698 I203N possibly damaging Het
Hltf T A 3: 20,083,832 probably null Het
Igkv3-2 G T 6: 70,698,517 probably benign Het
Mslnl A G 17: 25,746,073 D471G probably damaging Het
Msmo1 A G 8: 64,719,027 Y281H probably benign Het
Nid1 A G 13: 13,482,035 T584A probably benign Het
Olfr628 C T 7: 103,732,484 A186V probably damaging Het
Olfr908 A G 9: 38,516,265 T78A probably damaging Het
Otoa G A 7: 121,121,950 G396D probably damaging Het
Prss45 G T 9: 110,840,419 A197S probably damaging Het
Rpap2 T A 5: 107,620,238 I314N probably benign Het
Sash1 A G 10: 8,744,522 M458T probably damaging Het
Slc44a5 A G 3: 154,240,077 probably null Het
Sorbs2 T C 8: 45,772,614 S254P probably damaging Het
Sycp2 T C 2: 178,374,351 probably null Het
Tedc1 A G 12: 113,161,714 D252G probably damaging Het
Uty T C Y: 1,186,790 H145R probably damaging Homo
Vmn1r9 A G 6: 57,071,306 Y122C probably benign Het
Wdfy4 T A 14: 33,095,951 N1491Y possibly damaging Het
Wdr37 T C 13: 8,849,648 T140A probably benign Het
Other mutations in Ap3m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02628:Ap3m1 APN 14 21045520 nonsense probably null
IGL02815:Ap3m1 APN 14 21036682 missense probably damaging 1.00
R0268:Ap3m1 UTSW 14 21037102 splice site probably benign
R1780:Ap3m1 UTSW 14 21041070 missense probably benign 0.20
R1961:Ap3m1 UTSW 14 21041015 missense probably damaging 1.00
R2029:Ap3m1 UTSW 14 21039149 missense possibly damaging 0.94
R3903:Ap3m1 UTSW 14 21036664 missense probably null 1.00
R4837:Ap3m1 UTSW 14 21037157 missense probably damaging 1.00
R4952:Ap3m1 UTSW 14 21040066 missense probably benign 0.00
R5050:Ap3m1 UTSW 14 21044775 missense probably benign 0.00
R5741:Ap3m1 UTSW 14 21045720 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGAAAACCCTTGGCTAGAGTC -3'
(R):5'- ACATCTGGAGTTGTCCCATACC -3'

Sequencing Primer
(F):5'- TCTTGTTTAAGCAAGGCAAGGACC -3'
(R):5'- GGAGTTGTCCCATACCTTTCATAATG -3'
Posted On2018-08-29