Incidental Mutation 'R6765:Trpm6'
ID531893
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Nametransient receptor potential cation channel, subfamily M, member 6
SynonymsCHAK2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6765 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location18749983-18892510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18877765 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1929 (D1929E)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
Predicted Effect probably damaging
Transcript: ENSMUST00000040489
AA Change: D1929E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: D1929E

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik G T 3: 88,686,429 G42W probably damaging Het
3110002H16Rik A G 18: 12,176,146 N92D possibly damaging Het
Adamtsl3 C A 7: 82,567,024 D878E possibly damaging Het
Adipor2 A C 6: 119,357,242 F336V possibly damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Aoc1 A G 6: 48,905,937 N249S probably benign Het
Ap1b1 T A 11: 5,019,427 L261Q probably damaging Het
Ap3b1 T A 13: 94,462,509 D530E probably benign Het
Arid4b T A 13: 14,187,315 M788K possibly damaging Het
Atp2c2 A T 8: 119,753,017 I762F probably damaging Het
Bhlhe23 C A 2: 180,776,343 R134L probably damaging Het
Cacna2d3 T C 14: 29,055,977 D687G probably damaging Het
Ccdc136 G A 6: 29,405,941 M95I probably benign Het
Cdk12 T A 11: 98,224,529 I832N unknown Het
Clcn2 A C 16: 20,707,668 probably null Het
Csrnp2 C T 15: 100,482,693 R239Q probably damaging Het
Dhrs13 T A 11: 78,037,139 D270E probably benign Het
Dlgap2 G A 8: 14,743,284 G426D probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fam120a A G 13: 48,891,964 Y799H probably damaging Het
Fam160b1 A G 19: 57,378,745 D240G probably benign Het
Farp1 G A 14: 121,222,654 V112I probably benign Het
Fsip2 A G 2: 82,986,432 I4170V probably benign Het
Gm12185 A G 11: 48,915,704 V220A probably benign Het
Gpr37l1 T C 1: 135,167,122 Y128C probably damaging Het
Gsto2 A T 19: 47,871,788 R7* probably null Het
Itih3 C T 14: 30,909,473 G822D probably benign Het
Kcnu1 A T 8: 25,913,645 D728V probably damaging Het
Lnpep G A 17: 17,530,496 T976I probably damaging Het
Map1b A C 13: 99,425,941 H2420Q unknown Het
Mc1r A G 8: 123,407,696 K63E probably damaging Het
Mpped1 G A 15: 83,836,383 V15M probably damaging Het
Ncor1 T C 11: 62,373,446 T103A probably benign Het
Nhsl1 A T 10: 18,531,314 T1399S probably benign Het
Nlrc5 C T 8: 94,490,368 T995M probably benign Het
Nrbp1 G A 5: 31,245,846 probably null Het
Olfr1065 T C 2: 86,445,236 T249A probably benign Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr979 A C 9: 40,001,197 F10C probably damaging Het
Pcdhb13 T C 18: 37,443,610 L347P probably damaging Het
Pkhd1 T C 1: 20,058,339 T4047A probably benign Het
Prrt2 T A 7: 127,019,597 D232V probably damaging Het
Psmd5 A C 2: 34,856,533 M344R probably benign Het
Pwp1 G A 10: 85,884,533 E345K probably damaging Het
Qsox1 A G 1: 155,791,105 Y213H probably benign Het
Syne1 A T 10: 5,143,285 probably null Het
Tmem163 G T 1: 127,551,341 A147E probably damaging Het
Trav13n-4 A T 14: 53,364,100 M109L probably benign Het
Trp53bp1 T C 2: 121,209,309 E1283G probably damaging Het
Upb1 A T 10: 75,438,144 D335V probably damaging Het
Vps26b T C 9: 27,012,808 E213G probably damaging Het
Vwc2 C T 11: 11,154,215 T249I probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zan A G 5: 137,393,147 C4692R unknown Het
Zfp106 T C 2: 120,539,454 E29G probably damaging Het
Zfp551 G A 7: 12,416,840 A214V possibly damaging Het
Zfp981 T A 4: 146,537,906 H429Q probably benign Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1840:Trpm6 UTSW 19 18866267 missense probably benign 0.21
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACAGGTTTCTCGAGGTTTCC -3'
(R):5'- AAGCATGACTCTGTGCCTAC -3'

Sequencing Primer
(F):5'- TGGTCTACTGCCATTCAGCCAAC -3'
(R):5'- GTGCCTACATTTTCCCCTCAAAGAAG -3'
Posted On2018-08-29