Incidental Mutation 'R6817:Spdye4c'
ID537366
Institutional Source Beutler Lab
Gene Symbol Spdye4c
Ensembl Gene ENSMUSG00000074812
Gene Namespeedy/RINGO cell cycle regulator family, member E4C
SynonymsGm355, LOC241634
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location128591209-128598464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128596510 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 263 (Y263H)
Ref Sequence ENSEMBL: ENSMUSP00000135991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144559] [ENSMUST00000155430] [ENSMUST00000178601]
Predicted Effect probably damaging
Transcript: ENSMUST00000144559
AA Change: Y263H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140478
Gene: ENSMUSG00000074812
AA Change: Y263H

DomainStartEndE-ValueType
low complexity region 87 99 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Pfam:Spy1 204 335 1.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155430
SMART Domains Protein: ENSMUSP00000117916
Gene: ENSMUSG00000074812

DomainStartEndE-ValueType
low complexity region 87 99 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178601
AA Change: Y263H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135991
Gene: ENSMUSG00000074812
AA Change: Y263H

DomainStartEndE-ValueType
Pfam:Spy1 37 168 1.3e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Spdye4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Spdye4c APN 2 128592666 missense possibly damaging 0.89
R0616:Spdye4c UTSW 2 128594212 missense possibly damaging 0.94
R1072:Spdye4c UTSW 2 128596637 missense probably benign 0.02
R1455:Spdye4c UTSW 2 128596558 missense probably damaging 1.00
R1545:Spdye4c UTSW 2 128595712 missense probably benign 0.03
R1682:Spdye4c UTSW 2 128592622 missense probably damaging 0.96
R4668:Spdye4c UTSW 2 128592353 missense possibly damaging 0.46
R4669:Spdye4c UTSW 2 128592353 missense possibly damaging 0.46
R5287:Spdye4c UTSW 2 128592640 missense possibly damaging 0.83
R5445:Spdye4c UTSW 2 128596564 nonsense probably null
R5613:Spdye4c UTSW 2 128592969 missense possibly damaging 0.72
R5629:Spdye4c UTSW 2 128596785 missense probably damaging 1.00
R5786:Spdye4c UTSW 2 128596841 makesense probably null
R5911:Spdye4c UTSW 2 128596074 nonsense probably null
R5912:Spdye4c UTSW 2 128596074 nonsense probably null
R6008:Spdye4c UTSW 2 128596633 missense probably benign 0.00
R6856:Spdye4c UTSW 2 128596130 splice site probably null
R7402:Spdye4c UTSW 2 128592341 start codon destroyed probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGAGAAGTAAATGGGCTCTGTG -3'
(R):5'- TGAACCCATCCATGGTCTTC -3'

Sequencing Primer
(F):5'- TCTGTGTCCAGGATGCCC -3'
(R):5'- AGAACCCTGGCAGACCTCTG -3'
Posted On2018-10-18