Incidental Mutation 'R6817:Lrrc59'
ID537393
Institutional Source Beutler Lab
Gene Symbol Lrrc59
Ensembl Gene ENSMUSG00000020869
Gene Nameleucine rich repeat containing 59
SynonymsC78668
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94629767-94645216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 94630065 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 21 (D21H)
Ref Sequence ENSEMBL: ENSMUSP00000021239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021239]
Predicted Effect probably damaging
Transcript: ENSMUST00000021239
AA Change: D21H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021239
Gene: ENSMUSG00000020869
AA Change: D21H

DomainStartEndE-ValueType
LRR 38 60 6.22e0 SMART
LRR 61 83 1.33e-1 SMART
LRR 84 106 3.75e0 SMART
LRR 107 131 1.09e2 SMART
coiled coil region 148 216 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Meta Mutation Damage Score 0.366 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Lrrc59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Lrrc59 APN 11 94638600 nonsense probably null
IGL01525:Lrrc59 APN 11 94634696 missense probably damaging 0.99
IGL01929:Lrrc59 APN 11 94643516 missense possibly damaging 0.69
IGL01958:Lrrc59 APN 11 94638528 splice site probably null
IGL02635:Lrrc59 APN 11 94643456 missense probably damaging 1.00
R0277:Lrrc59 UTSW 11 94643422 missense probably damaging 1.00
R0323:Lrrc59 UTSW 11 94643422 missense probably damaging 1.00
R1794:Lrrc59 UTSW 11 94638595 missense probably benign
R4833:Lrrc59 UTSW 11 94634672 missense probably benign 0.00
R6242:Lrrc59 UTSW 11 94634983 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGATGCAGTTTGCCAGCCTG -3'
(R):5'- AAAGTGACACGTGTGCACC -3'

Sequencing Primer
(F):5'- ACGGAAGTGGTCGTCGTC -3'
(R):5'- CGTGTGCACCGCAATAAG -3'
Posted On2018-10-18