Incidental Mutation 'R6914:Trip11'
ID539246
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Namethyroid hormone receptor interactor 11
SynonymsGMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230
MMRRC Submission
Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6914 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location101834043-101913267 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101846620 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1485 (N1485S)
Ref Sequence ENSEMBL: ENSMUSP00000134976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000177183]
Predicted Effect probably benign
Transcript: ENSMUST00000021605
AA Change: N1770S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: N1770S

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177183
AA Change: N1485S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: N1485S

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,011,297 K17* probably null Het
Abca6 T C 11: 110,190,238 I1183V probably benign Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
C530008M17Rik A T 5: 76,857,007 Q405L unknown Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cblb G A 16: 52,047,430 E134K probably damaging Het
Ccdc158 A G 5: 92,662,070 V193A probably benign Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Csmd3 C A 15: 48,011,138 R687S possibly damaging Het
Derl3 A G 10: 75,894,216 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dnaic1 T G 4: 41,625,176 M380R probably benign Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Gas7 A T 11: 67,660,151 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpt C A 15: 76,697,592 Q138K probably benign Het
Greb1 T A 12: 16,707,902 E748V probably damaging Het
Hecw1 A C 13: 14,316,838 L523R probably damaging Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Mccc2 C A 13: 99,990,350 D137Y probably damaging Het
Nupl2 T A 5: 24,181,084 S205T probably damaging Het
Pde8b T A 13: 95,086,844 M301L probably benign Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pom121 A T 5: 135,378,157 F1175I probably damaging Het
Prom2 T G 2: 127,530,375 I723L possibly damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc26a2 A C 18: 61,199,279 I360S probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tbx20 T C 9: 24,725,483 H436R probably benign Het
Tle2 T C 10: 81,586,356 Y411H probably damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Vezt A T 10: 93,970,451 H699Q probably benign Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101886147 missense probably benign 0.37
IGL00484:Trip11 APN 12 101885311 nonsense probably null
IGL00972:Trip11 APN 12 101894337 missense probably null 1.00
IGL01476:Trip11 APN 12 101898911 missense probably damaging 0.96
IGL01591:Trip11 APN 12 101883345 missense probably damaging 0.98
IGL01667:Trip11 APN 12 101878862 missense probably damaging 1.00
IGL01764:Trip11 APN 12 101884631 missense probably damaging 1.00
IGL01789:Trip11 APN 12 101871831 missense probably benign 0.05
IGL01814:Trip11 APN 12 101884488 missense probably damaging 0.98
IGL01898:Trip11 APN 12 101885676 missense probably benign
IGL01924:Trip11 APN 12 101886884 missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101884313 missense probably damaging 1.00
IGL02475:Trip11 APN 12 101895683 missense probably benign 0.01
IGL02544:Trip11 APN 12 101893521 missense probably damaging 1.00
IGL02678:Trip11 APN 12 101883390 missense probably damaging 0.96
IGL02714:Trip11 APN 12 101884001 missense probably damaging 1.00
IGL02718:Trip11 APN 12 101886025 missense probably benign 0.24
IGL02904:Trip11 APN 12 101886838 missense probably damaging 1.00
IGL03012:Trip11 APN 12 101883936 missense probably damaging 1.00
IGL03191:Trip11 APN 12 101898925 missense probably damaging 1.00
IGL03327:Trip11 APN 12 101883418 missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101885019 missense probably damaging 1.00
NA:Trip11 UTSW 12 101894321 unclassified probably null
R0027:Trip11 UTSW 12 101885169 missense probably benign 0.00
R0028:Trip11 UTSW 12 101884757 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0505:Trip11 UTSW 12 101885672 missense probably damaging 0.98
R0556:Trip11 UTSW 12 101884518 nonsense probably null
R0573:Trip11 UTSW 12 101886860 missense probably benign 0.02
R0626:Trip11 UTSW 12 101885976 missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101886160 missense probably benign 0.04
R1530:Trip11 UTSW 12 101912767 missense unknown
R1647:Trip11 UTSW 12 101884392 nonsense probably null
R1648:Trip11 UTSW 12 101884392 nonsense probably null
R1856:Trip11 UTSW 12 101883333 nonsense probably null
R2013:Trip11 UTSW 12 101837722 missense probably damaging 1.00
R2017:Trip11 UTSW 12 101885360 missense probably benign 0.00
R2206:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2207:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2304:Trip11 UTSW 12 101898977 missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101878827 makesense probably null
R2513:Trip11 UTSW 12 101837727 missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101893694 missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101894322 nonsense probably null
R4124:Trip11 UTSW 12 101895698 nonsense probably null
R4126:Trip11 UTSW 12 101895698 nonsense probably null
R4128:Trip11 UTSW 12 101895698 nonsense probably null
R4175:Trip11 UTSW 12 101895698 nonsense probably null
R4176:Trip11 UTSW 12 101895698 nonsense probably null
R4181:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4296:Trip11 UTSW 12 101885868 nonsense probably null
R4302:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4306:Trip11 UTSW 12 101886939 missense probably benign
R4342:Trip11 UTSW 12 101884316 missense probably damaging 1.00
R4576:Trip11 UTSW 12 101886240 nonsense probably null
R4586:Trip11 UTSW 12 101883341 missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101837616 missense probably damaging 1.00
R4696:Trip11 UTSW 12 101885290 missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101885446 missense probably benign 0.10
R4903:Trip11 UTSW 12 101886806 critical splice donor site probably null
R5001:Trip11 UTSW 12 101884910 nonsense probably null
R5017:Trip11 UTSW 12 101846620 missense probably benign 0.00
R5227:Trip11 UTSW 12 101884920 missense probably damaging 1.00
R5231:Trip11 UTSW 12 101885601 missense probably damaging 0.96
R5539:Trip11 UTSW 12 101885127 missense probably damaging 0.98
R5754:Trip11 UTSW 12 101885665 nonsense probably null
R5755:Trip11 UTSW 12 101885665 nonsense probably null
R5890:Trip11 UTSW 12 101885972 missense probably damaging 0.99
R5910:Trip11 UTSW 12 101883479 missense probably damaging 1.00
R6083:Trip11 UTSW 12 101889742 missense probably benign 0.00
R6208:Trip11 UTSW 12 101898895 missense probably damaging 1.00
R6216:Trip11 UTSW 12 101890600 missense probably benign 0.31
R6315:Trip11 UTSW 12 101885578 missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101885531 missense probably benign 0.12
R6590:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6938:Trip11 UTSW 12 101837627 missense probably damaging 0.98
R7015:Trip11 UTSW 12 101893683 missense probably damaging 1.00
R7023:Trip11 UTSW 12 101885867 missense probably benign 0.13
R7133:Trip11 UTSW 12 101884070 missense probably damaging 0.97
R7271:Trip11 UTSW 12 101884352 missense probably damaging 1.00
R7424:Trip11 UTSW 12 101885198 missense probably damaging 1.00
R7431:Trip11 UTSW 12 101884019 missense possibly damaging 0.84
X0020:Trip11 UTSW 12 101885913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTATTCCACTGACTGTCATAGAAACC -3'
(R):5'- GTAATAGCGGCCTAAGTTCCC -3'

Sequencing Primer
(F):5'- TGACTGTCATAGAAACCACCTC -3'
(R):5'- TAGCGGCCTAAGTTCCCTGAAC -3'
Posted On2018-11-06