Incidental Mutation 'R7016:Adam1a'
ID545298
Institutional Source Beutler Lab
Gene Symbol Adam1a
Ensembl Gene ENSMUSG00000072647
Gene Namea disintegrin and metallopeptidase domain 1a
Synonymsfertilin alpha, Ftna, PH-30 alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7016 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121518576-121545482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121521038 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 64 (F64S)
Ref Sequence ENSEMBL: ENSMUSP00000098320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031410] [ENSMUST00000100757] [ENSMUST00000111782] [ENSMUST00000111783] [ENSMUST00000111786] [ENSMUST00000111795] [ENSMUST00000125946] [ENSMUST00000156080] [ENSMUST00000200170]
Predicted Effect probably benign
Transcript: ENSMUST00000031410
SMART Domains Protein: ENSMUSP00000031410
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 409 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100757
AA Change: F64S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000098320
Gene: ENSMUSG00000072647
AA Change: F64S

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 70 191 1.5e-18 PFAM
Pfam:Reprolysin_5 233 410 2.8e-15 PFAM
Pfam:Reprolysin_4 234 421 6.3e-9 PFAM
Pfam:Reprolysin 235 429 1.3e-70 PFAM
Pfam:Reprolysin_3 255 381 3.8e-14 PFAM
Pfam:Reprolysin_2 255 419 5.6e-9 PFAM
DISIN 447 520 6.45e-37 SMART
ACR 521 660 4.59e-62 SMART
EGF 666 697 1.99e1 SMART
transmembrane domain 741 763 N/A INTRINSIC
low complexity region 764 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111782
SMART Domains Protein: ENSMUSP00000107412
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
Pfam:Pkinase 6 155 3.7e-27 PFAM
coiled coil region 258 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111783
SMART Domains Protein: ENSMUSP00000107413
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111786
SMART Domains Protein: ENSMUSP00000107416
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
Pfam:Pkinase 6 155 3.8e-27 PFAM
coiled coil region 260 285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111795
SMART Domains Protein: ENSMUSP00000144614
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125946
SMART Domains Protein: ENSMUSP00000142503
Gene: ENSMUSG00000105340

DomainStartEndE-ValueType
S_TKc 22 304 5.3e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152270
SMART Domains Protein: ENSMUSP00000116464
Gene: ENSMUSG00000029454

DomainStartEndE-ValueType
coiled coil region 49 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156080
SMART Domains Protein: ENSMUSP00000121579
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200170
SMART Domains Protein: ENSMUSP00000143668
Gene: ENSMUSG00000072647

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Homozygous null mice display male infertility with asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smarcc2 T G 10: 128,485,329 probably null Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Adam1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Adam1a APN 5 121519376 missense probably benign 0.09
IGL01467:Adam1a APN 5 121519728 missense probably damaging 1.00
IGL02158:Adam1a APN 5 121518971 nonsense probably null
R1468:Adam1a UTSW 5 121519776 intron probably null
R1468:Adam1a UTSW 5 121519776 intron probably null
R1593:Adam1a UTSW 5 121519643 missense probably benign 0.02
R1848:Adam1a UTSW 5 121519620 missense probably damaging 1.00
R1925:Adam1a UTSW 5 121519450 nonsense probably null
R2176:Adam1a UTSW 5 121519586 missense probably benign 0.01
R2232:Adam1a UTSW 5 121519732 missense possibly damaging 0.93
R3692:Adam1a UTSW 5 121519322 missense probably damaging 1.00
R4732:Adam1a UTSW 5 121519434 missense probably benign 0.34
R4733:Adam1a UTSW 5 121519434 missense probably benign 0.34
R4835:Adam1a UTSW 5 121519689 missense probably damaging 1.00
R5199:Adam1a UTSW 5 121521152 missense probably benign 0.23
R6026:Adam1a UTSW 5 121519362 missense probably damaging 1.00
R6936:Adam1a UTSW 5 121519362 missense probably damaging 1.00
R7124:Adam1a UTSW 5 121519334 missense probably benign 0.15
R7294:Adam1a UTSW 5 121520005 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCCATTGTGGTAACTGTAGAC -3'
(R):5'- CATCAGCAGTTTGTTGGAGCC -3'

Sequencing Primer
(F):5'- ACTGTAGACTGGGAAGTTATTCTC -3'
(R):5'- ATGTCAGTGGCAGCAGC -3'
Posted On2019-05-13