Incidental Mutation 'R7016:Sim1'
ID545319
Institutional Source Beutler Lab
Gene Symbol Sim1
Ensembl Gene ENSMUSG00000019913
Gene Namesingle-minded family bHLH transcription factor 1
SynonymsbHLHe14
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7016 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location50894754-50989152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50984250 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 736 (S736L)
Ref Sequence ENSEMBL: ENSMUSP00000020071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020071]
Predicted Effect probably benign
Transcript: ENSMUST00000020071
AA Change: S736L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020071
Gene: ENSMUSG00000019913
AA Change: S736L

DomainStartEndE-ValueType
HLH 6 59 8.73e-6 SMART
PAS 79 145 7.39e-14 SMART
PAS 220 286 5.61e-5 SMART
PAC 292 335 4.63e-6 SMART
Pfam:SIM_C 359 668 2.5e-114 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIM1 and SIM2 genes are Drosophila single-minded (sim) gene homologs. SIM1 transcript was detected only in fetal kidney out of various adult and fetal tissues tested. Since the sim gene plays an important role in Drosophila development and has peak levels of expression during the period of neurogenesis,it was proposed that the human SIM gene is a candidate for involvement in certain dysmorphic features (particularly the facial and skull characteristics), abnormalities of brain development, and/or mental retardation of Down syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with abnormalities in the paraventricular and supraoptic nuclei. Heterozygous mutant mice are obese and may also be diabetic, hyperinsulinemic and insulin resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Smarcc2 T G 10: 128,485,329 probably null Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Sim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Sim1 APN 10 50981534 missense probably damaging 0.99
IGL01142:Sim1 APN 10 50910671 missense probably damaging 0.99
IGL01886:Sim1 APN 10 50984315 missense probably damaging 1.00
PIT4585001:Sim1 UTSW 10 50984188 nonsense probably null
R0128:Sim1 UTSW 10 50907961 missense probably damaging 1.00
R0130:Sim1 UTSW 10 50907961 missense probably damaging 1.00
R0717:Sim1 UTSW 10 50909828 missense probably damaging 1.00
R0948:Sim1 UTSW 10 50981327 nonsense probably null
R1169:Sim1 UTSW 10 50981522 missense probably benign 0.13
R1388:Sim1 UTSW 10 50895994 missense probably damaging 1.00
R1746:Sim1 UTSW 10 50984109 missense probably benign
R1778:Sim1 UTSW 10 50981553 nonsense probably null
R1834:Sim1 UTSW 10 50909828 missense probably damaging 1.00
R2434:Sim1 UTSW 10 50907958 missense probably damaging 1.00
R2919:Sim1 UTSW 10 50909815 missense probably benign 0.23
R3617:Sim1 UTSW 10 50909528 missense probably damaging 1.00
R3625:Sim1 UTSW 10 50981336 missense probably benign 0.30
R4152:Sim1 UTSW 10 50983854 missense probably damaging 0.98
R4414:Sim1 UTSW 10 50981612 missense probably benign 0.13
R4645:Sim1 UTSW 10 50983997 missense probably benign 0.13
R4781:Sim1 UTSW 10 50983785 missense probably benign 0.08
R4889:Sim1 UTSW 10 50981324 missense probably benign 0.05
R4924:Sim1 UTSW 10 50909902 missense probably damaging 1.00
R6625:Sim1 UTSW 10 50983986 missense probably benign
R6783:Sim1 UTSW 10 50908727 missense possibly damaging 0.72
R6876:Sim1 UTSW 10 50983695 missense possibly damaging 0.77
R6909:Sim1 UTSW 10 50909410 missense possibly damaging 0.92
R6924:Sim1 UTSW 10 50908539 missense probably benign 0.10
R7135:Sim1 UTSW 10 50895927 missense probably damaging 0.99
R7149:Sim1 UTSW 10 50909540 missense probably damaging 1.00
R7300:Sim1 UTSW 10 50909518 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CCTAGTTCTGATCGCATTACAAAG -3'
(R):5'- TGGCATAGTAAATGTTGCTAATGGG -3'

Sequencing Primer
(F):5'- CCTGGCTAAAGACTATCTACATTCAG -3'
(R):5'- ACAGATGTTCCCTTGTGT -3'
Posted On2019-05-13