Incidental Mutation 'R1101:Olfr1290'
ID98066
Institutional Source Beutler Lab
Gene Symbol Olfr1290
Ensembl Gene ENSMUSG00000095809
Gene Nameolfactory receptor 1290
SynonymsGA_x6K02T2Q125-72541649-72540711, MOR248-9
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1101 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111487528-111493829 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111489442 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 239 (T239A)
Ref Sequence ENSEMBL: ENSMUSP00000150388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099616] [ENSMUST00000120021] [ENSMUST00000208695] [ENSMUST00000208881] [ENSMUST00000217611]
Predicted Effect probably damaging
Transcript: ENSMUST00000099616
AA Change: T239A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097211
Gene: ENSMUSG00000095809
AA Change: T239A

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.5e-52 PFAM
Pfam:7tm_1 41 287 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207707
AA Change: T239A
Predicted Effect probably benign
Transcript: ENSMUST00000208695
Predicted Effect probably benign
Transcript: ENSMUST00000208881
Predicted Effect probably damaging
Transcript: ENSMUST00000217611
AA Change: T239A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fam83b A T 9: 76,545,670 H38Q possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Olfr1290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr1290 APN 2 111489220 makesense probably null
IGL01418:Olfr1290 APN 2 111489639 missense probably benign 0.37
IGL02288:Olfr1290 APN 2 111489720 missense probably benign 0.09
IGL02507:Olfr1290 APN 2 111489423 missense possibly damaging 0.87
IGL02508:Olfr1290 APN 2 111489835 missense probably damaging 1.00
IGL02951:Olfr1290 APN 2 111490120 missense probably benign 0.00
IGL03357:Olfr1290 APN 2 111489944 missense probably benign 0.01
R2256:Olfr1290 UTSW 2 111489978 missense probably damaging 1.00
R2420:Olfr1290 UTSW 2 111489257 unclassified probably null
R4672:Olfr1290 UTSW 2 111489557 missense possibly damaging 0.66
R4715:Olfr1290 UTSW 2 111489744 missense probably benign
R4855:Olfr1290 UTSW 2 111489948 missense probably damaging 1.00
R6011:Olfr1290 UTSW 2 111489847 missense probably benign 0.03
R6141:Olfr1290 UTSW 2 111490119 missense probably benign 0.34
R6156:Olfr1290 UTSW 2 111489750 missense probably damaging 1.00
R6702:Olfr1290 UTSW 2 111490109 synonymous probably null
R6703:Olfr1290 UTSW 2 111490109 synonymous probably null
R7413:Olfr1290 UTSW 2 111489588 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GCTGTGTTCATGCAAAAGTGGAAACC -3'
(R):5'- AGCTTGCATAGATTCCCGTGACTTG -3'

Sequencing Primer
(F):5'- CTGTGTAGGAAAAGCATGTCTG -3'
(R):5'- CCCGTGACTTGGATGTTCTAATG -3'
Posted On2014-01-05