Incidental Mutation 'R1101:Fam83b'
ID98100
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Namefamily with sequence similarity 83, member B
SynonymsC530008M07Rik
MMRRC Submission 039174-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1101 (G1)
Quality Score180
Status Not validated
Chromosome9
Chromosomal Location76490054-76567116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76545670 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 38 (H38Q)
Ref Sequence ENSEMBL: ENSMUSP00000139354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098546
AA Change: H38Q

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: H38Q

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183437
AA Change: H38Q

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: H38Q

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,411 I249M possibly damaging Het
2610021A01Rik C A 7: 41,627,359 H829N probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abi3bp G T 16: 56,606,158 R512L probably damaging Het
Acot2 T G 12: 83,992,850 S378A probably benign Het
Akap9 T C 5: 4,046,205 I2360T probably benign Het
Bank1 T C 3: 136,283,864 D155G probably benign Het
Bsn A G 9: 108,116,411 V714A probably damaging Het
Cdh15 G A 8: 122,860,846 V170I possibly damaging Het
Clcn2 G A 16: 20,703,595 T787I probably damaging Het
Dapk1 A G 13: 60,716,785 H131R probably damaging Het
Dct T G 14: 118,036,622 D291A probably damaging Het
Dhx37 A G 5: 125,415,152 Y1128H probably damaging Het
Dip2c A T 13: 9,634,744 I1174F probably damaging Het
Eif3l A G 15: 79,075,267 Y3C probably damaging Het
Enpp5 A G 17: 44,081,367 N229S possibly damaging Het
Fcamr T A 1: 130,814,486 probably null Het
Hdac2 G A 10: 36,991,809 V184I probably damaging Het
Igf2bp2 A T 16: 22,162,950 L5Q probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Ireb2 T A 9: 54,909,702 H951Q probably benign Het
Lman1 T A 18: 65,987,898 M418L probably benign Het
Lrrfip2 C T 9: 111,190,225 R275W probably damaging Het
Mast3 T A 8: 70,786,663 I424F probably damaging Het
Mep1a T C 17: 43,491,693 D147G probably benign Het
Mtr C A 13: 12,189,525 E1128D possibly damaging Het
Ogfod1 C A 8: 94,064,304 S534R probably benign Het
Olfr1212 A T 2: 88,958,984 I173F possibly damaging Het
Olfr1290 T C 2: 111,489,442 T239A probably damaging Het
Olfr173 A G 16: 58,797,252 V198A probably benign Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcdh18 T A 3: 49,753,379 D882V probably damaging Het
Pik3cg C T 12: 32,195,646 G868S probably null Het
Plppr5 T G 3: 117,662,523 M231R probably damaging Het
Polr2a T C 11: 69,748,071 T46A probably benign Het
Ppp4r3a C A 12: 101,051,571 R440L probably damaging Het
Serpinb9e A T 13: 33,260,088 T364S probably benign Het
Sirt3 A G 7: 140,869,628 V135A possibly damaging Het
Supt16 T C 14: 52,171,439 N826S probably null Het
Tbr1 T C 2: 61,804,739 I11T probably benign Het
Trim72 A G 7: 128,010,247 E407G possibly damaging Het
Vps72 C A 3: 95,119,176 T144K probably damaging Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76490978 missense probably benign 0.00
IGL01554:Fam83b APN 9 76502121 missense probably benign 0.33
IGL01694:Fam83b APN 9 76490990 missense probably benign 0.13
IGL02009:Fam83b APN 9 76492322 missense probably damaging 1.00
IGL02531:Fam83b APN 9 76492000 missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76493042 missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76491152 missense probably damaging 1.00
R0110:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76492928 nonsense probably null
R0946:Fam83b UTSW 9 76491397 missense probably damaging 0.96
R0961:Fam83b UTSW 9 76491295 missense probably damaging 0.97
R1200:Fam83b UTSW 9 76492312 missense probably damaging 1.00
R1248:Fam83b UTSW 9 76503076 missense probably benign 0.35
R1420:Fam83b UTSW 9 76492612 missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76492577 missense probably benign
R1939:Fam83b UTSW 9 76493080 missense probably damaging 1.00
R1992:Fam83b UTSW 9 76492022 missense probably benign
R2102:Fam83b UTSW 9 76492705 missense probably damaging 0.96
R2134:Fam83b UTSW 9 76491016 missense probably damaging 1.00
R2398:Fam83b UTSW 9 76502218 missense probably damaging 1.00
R2878:Fam83b UTSW 9 76490810 missense probably damaging 1.00
R4092:Fam83b UTSW 9 76491661 missense probably benign 0.24
R4204:Fam83b UTSW 9 76503053 missense probably benign 0.09
R4537:Fam83b UTSW 9 76492142 missense probably benign 0.10
R4920:Fam83b UTSW 9 76491868 missense probably benign
R5456:Fam83b UTSW 9 76492595 missense probably benign
R5473:Fam83b UTSW 9 76491500 missense probably damaging 1.00
R5488:Fam83b UTSW 9 76545599 missense probably benign 0.05
R5489:Fam83b UTSW 9 76545599 missense probably benign 0.05
R5876:Fam83b UTSW 9 76491850 missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76492357 missense probably damaging 1.00
R6374:Fam83b UTSW 9 76492907 missense probably benign 0.31
R6468:Fam83b UTSW 9 76502131 nonsense probably null
R6912:Fam83b UTSW 9 76490932 missense probably damaging 0.99
R7022:Fam83b UTSW 9 76502112 frame shift probably null
R7073:Fam83b UTSW 9 76545749 missense probably benign 0.18
R7356:Fam83b UTSW 9 76492853 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CGAGCCGTCATCACAGGAACTATC -3'
(R):5'- AGTTGAGTAGCTGTCCCGTATCCC -3'

Sequencing Primer
(F):5'- CGTCATCACAGGAACTATCAGAAC -3'
(R):5'- ATCCCTGGAGAGGTCAAGTTC -3'
Posted On2014-01-05