Phenotypic Mutation 'cruyff' (pdf version)
List |< first << previous [record 93 of 511] next >> last >|
Allelecruyff
Mutation Type missense
Chromosome4
Coordinate66,840,326 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Tlr4
Gene Name toll-like receptor 4
Synonym(s) Rasl2-8, Lps, lipopolysaccharide response
Chromosomal Location 66,827,584-66,930,284 bp (+)
MGI Phenotype Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria.
Accession Number

NCBI RefSeq: NM_021297.2; MGI:96824

Mapped Yes 
Amino Acid Change Isoleucine changed to Asparagine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000045770]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: I452N

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000048096)
Phenotypic Category Macrophage necroptosis: low, NLRP3 inflammasome: low response, TLR signaling defect: hyposensitivity to LPS
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(18) : Chemically induced (ENU)(6) Spontaneous(6) Targeted(6)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.00
IGL01343:Tlr4 APN 4 66833887 splice acceptor site probably benign 0.00
IGL01669:Tlr4 APN 4 66841267 missense probably benign 0.30
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense possibly damaging 0.78
IGL02244:Tlr4 APN 4 66834061 splice site 0.00
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 0.97
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 0.99
IGL03288:Tlr4 APN 4 66839753 missense possibly damaging 0.70
bugsy UTSW 4 66839254 nonsense probably null
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense
Lops UTSW 4 66833880 splice acceptor site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.00
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice acceptor site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5112:Tlr4 UTSW 4 66833914 missense noncoding transcript
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 1.00
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 12/09/2016 10:17 AM by Katherine Timer
Record Created 02/26/2016 6:40 AM by Cristhiaan D. Ochoa
Record Posted 04/28/2016
Phenotypic Description
Figure 1. Cruyff mice exhibited reduced TNFα secretion in response to the TLR4 ligand, LPS. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Cruyff mice exhibited resistance to macrophage necroptosis in response to the TLR4 ligand, LPS. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Cruyff mice secreted decreased amounts of IL-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The cruyff phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4213, some of which showed reduced TNFα secretion from macrophages in response to the Toll-like receptor 4 (TLR4) ligand, lipolysaccharide (LPS) (Figure 1) and resistance to LPS-induced macrophage necroptosis (Figure 2). Some mice also exhibited attenuated inflammatory responses related to decreased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (Figure 3).

Nature of Mutation
Figure 4. Linkage mapping of the increased LPS-induced necroptosis of macrophage cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations identified in the G1 male of pedigree R4213 (X-axis). Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. All of the above phenotypes were linked by continuous variable mapping to a mutation in Tlr4:  a T to A transversion at base pair 66,840,326 (v38) on chromosome 4, or base pair 12,516 in the GenBank genomic region NC_000070. The strongest association was found with a recessive model of linkage to the resistance to LPS-induced macrophage necroptosis, wherein 9 variant homozygotes departed phenotypically from 4 homozygous reference mice and 12 heterozygous mice with a P value of 1.859 x 10-19 (Figure 4).  

 

The mutation corresponds to residue 1,636 in the mRNA sequence NM_021297 within exon 3 of 3 total exons.

 

1620 CTACTTTACCTTGACATCTCTTATACTAACACC

447  -L--L--Y--L--D--I--S--Y--T--N--T-

 

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine (I) to asparagine (N) substitution at position 452 (I452N) in the TLR4 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction

Figure 4. Protein and domain structure of TLR4. A) Schematic representation of TLR9 based on crystalized structures of mouse TLR3 LRR (PBD 3CIG) and human TLR2 TIR (1FYW) domains. The residue affected by the Lps3 mutation is highlighted. 3D image was created using UCSF Chimera. B) TLR4 is an 835 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The cruyff mutation (red asterisk) results in an esults in substitution of isoleucine (I) 425 to an asparagine (I452N) in the TLR4 protein. This image is interactive. Click on the image to view other mutations found in TLR4 (red). Click on the mutations for more specific information.

TLR4 is a type I integral membrane glycoprotein containing 835 amino acids. TLR4 has 22 predicted leucine-rich repeats (LRRs) in its ectodomain at the N-terminal half of the protein (1-3), a transmembrane domain, and a cytoplasmic Toll/IL-1R (TIR) domain (Figure 5). The cruyff mutation results in substitution of isoleucine 452 to an asparagine (I452N); amino acid 452 is located in LRR16.

 
Please see the record for lps3 for information about Tlr4.
Putative Mechanism

TLR4 is the receptor for LPS (4). Stimulation of TLR4 by LPS activates two branches of signaling, one defined by early NF-κB activation (MyD88-dependent pathway, mediated by MyD88), and another distinguished by late NF-κB activation as well as interferon responsive factor (IRF)-3 activation leading to type I IFN production and costimulatory molecule upregulation (MyD88-independent pathway, mediated by Trif) (5-7). The MyD88-dependent pathway activates expression of target genes including interleukin (IL)-6, IL-1, TNF, IL-12p40 and type I interferon (IFN), cytokines required for the inflammatory response. The MyD88-independent pathway results in the production of type I IFN. The reduction in TLR4-associated responses in cruyff indicates that the mutation results in loss of TLR4 function.

Primers PCR Primer
cruyff(F):5'- GTAGAAATGCACTGAGCTTTAGTGG -3'
cruyff(R):5'- CCCCAAGATATTTGTTCCAATTGAC -3'

Sequencing Primer
cruyff_seq(F):5'- GCTGTTCTTATTCTGATTTGGGAAC -3'
cruyff_seq(R):5'- CCAATTGACATTTAGAAAGATCCAGG -3'
References

  1. Rock, F. L., Hardiman, G., Timans, J. C., Kastelein, R. A., and Bazan, J. F. (1998) A Family of Human Receptors Structurally Related to Drosophila Toll. Proc Natl Acad Sci U S A. 95, 588-593.

  2. Medzhitov, R., Preston-Hurlburt, P., and Janeway, C. A.,Jr. (1997) A Human Homologue of the Drosophila Toll Protein Signals Activation of Adaptive Immunity. Nature. 388, 394-397.

  3. Bell, J. K., Mullen, G. E., Leifer, C. A., Mazzoni, A., Davies, D. R., and Segal, D. M. (2003) Leucine-Rich Repeats and Pathogen Recognition in Toll-Like Receptors. Trends Immunol. 24, 528-533.

  4. Poltorak, A., He, X., Smirnova, I., Liu, M. -., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M. A., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. (1998) Defective LPS Signaling in C3H/HeJ and C57BL/10ScCr Mice: Mutations in Tlr4 gene. Science. 282, 2085-2088.

  5. Kawai, T., Adachi, O., Ogawa, T., Takeda, K., and Akira, S. (1999) Unresponsiveness of MyD88-Deficient Mice to Endotoxin. Immunity. 11, 115-122.

  6. Hoshino, K., Kaisho, T., Iwabe, T., Takeuchi, O., and Akira, S. (2002) Differential Involvement of IFN-Beta in Toll-Like Receptor-Stimulated Dendritic Cell Activation. Int Immunol. 14, 1225-1231.

  7. Kawai, T., Takeuchi, O., Fujita, T., Inoue, J., Muhlradt, P. F., Sato, S., Hoshino, K., and Akira, S. (2001) Lipopolysaccharide Stimulates the MyD88-Independent Pathway and Results in Activation of IFN-Regulatory Factor 3 and the Expression of a Subset of Lipopolysaccharide-Inducible Genes. J Immunol. 167, 5887-5894.

Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCristhiaan D. Ochoa, Ying Wang, Hexin Shi, and Bruce Beutler
List |< first << previous [record 93 of 511] next >> last >|