Incidental Mutation 'R1255:Nipal2'
ID151430
Institutional Source Beutler Lab
Gene Symbol Nipal2
Ensembl Gene ENSMUSG00000038879
Gene NameNIPA-like domain containing 2
SynonymsNpal2, 9330161F08Rik
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R1255 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location34572799-34679212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34584682 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 247 (I247V)
Ref Sequence ENSEMBL: ENSMUSP00000038922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040791]
Predicted Effect probably benign
Transcript: ENSMUST00000040791
AA Change: I247V

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038922
Gene: ENSMUSG00000038879
AA Change: I247V

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 45 332 1.5e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228679
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsf3 T C 8: 122,785,966 probably null Het
Aff3 A T 1: 38,204,884 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Atxn3 T A 12: 101,934,334 Q230L probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Dennd5b A T 6: 149,041,650 M576K possibly damaging Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gimap1 T A 6: 48,743,006 V184E probably benign Het
Gtf2f1 A G 17: 57,010,982 V18A probably damaging Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Olfr992 T A 2: 85,400,303 I77F probably damaging Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Slc47a1 A T 11: 61,370,148 L142Q probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Spz1 C A 13: 92,575,630 V113F probably benign Het
Tcn2 T C 11: 3,922,120 T336A probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1l T C 10: 89,745,270 I9T probably damaging Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Nipal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nipal2 APN 15 34600078 missense probably damaging 1.00
IGL01555:Nipal2 APN 15 34600118 splice site probably benign
IGL02882:Nipal2 APN 15 34600077 missense probably damaging 1.00
IGL03230:Nipal2 APN 15 34575556 missense probably damaging 0.97
PIT4486001:Nipal2 UTSW 15 34584729 missense probably damaging 0.99
R0603:Nipal2 UTSW 15 34650398 missense probably damaging 0.97
R1530:Nipal2 UTSW 15 34625022 makesense probably null
R1673:Nipal2 UTSW 15 34648695 missense probably damaging 0.99
R1857:Nipal2 UTSW 15 34678633 missense possibly damaging 0.93
R1888:Nipal2 UTSW 15 34625021 missense possibly damaging 0.49
R1888:Nipal2 UTSW 15 34625021 missense possibly damaging 0.49
R3825:Nipal2 UTSW 15 34578706 critical splice donor site probably null
R4016:Nipal2 UTSW 15 34600061 missense possibly damaging 0.91
R4656:Nipal2 UTSW 15 34577568 critical splice donor site probably null
R6159:Nipal2 UTSW 15 34600026 missense probably damaging 1.00
R7082:Nipal2 UTSW 15 34584663 missense possibly damaging 0.95
R7263:Nipal2 UTSW 15 34578758 nonsense probably null
R8135:Nipal2 UTSW 15 34678573 missense possibly damaging 0.90
R8234:Nipal2 UTSW 15 34600032 missense possibly damaging 0.93
X0065:Nipal2 UTSW 15 34609261 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGAGACCCATTGTATTTCAGCTCG -3'
(R):5'- CCTTGCTCCAGAAGATGAAGGCAC -3'

Sequencing Primer
(F):5'- CAGCTCGATTATTTTCTAAGCCAGTG -3'
(R):5'- tgtgtgtgtgtgtgtCCC -3'
Posted On2014-01-29