Incidental Mutation 'R1255:Gtf2f1'
ID151435
Institutional Source Beutler Lab
Gene Symbol Gtf2f1
Ensembl Gene ENSMUSG00000002658
Gene Namegeneral transcription factor IIF, polypeptide 1
Synonyms
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1255 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57003405-57011288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57010982 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 18 (V18A)
Ref Sequence ENSEMBL: ENSMUSP00000002733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002733] [ENSMUST00000210548]
Predicted Effect probably damaging
Transcript: ENSMUST00000002733
AA Change: V18A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002733
Gene: ENSMUSG00000002658
AA Change: V18A

DomainStartEndE-ValueType
Pfam:TFIIF_alpha 2 508 2.6e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210548
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsf3 T C 8: 122,785,966 probably null Het
Aff3 A T 1: 38,204,884 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Atxn3 T A 12: 101,934,334 Q230L probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Dennd5b A T 6: 149,041,650 M576K possibly damaging Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gimap1 T A 6: 48,743,006 V184E probably benign Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Nipal2 T C 15: 34,584,682 I247V probably benign Het
Olfr992 T A 2: 85,400,303 I77F probably damaging Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Slc47a1 A T 11: 61,370,148 L142Q probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Spz1 C A 13: 92,575,630 V113F probably benign Het
Tcn2 T C 11: 3,922,120 T336A probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1l T C 10: 89,745,270 I9T probably damaging Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Gtf2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02737:Gtf2f1 APN 17 57003918 missense possibly damaging 0.86
IGL02752:Gtf2f1 APN 17 57009682 unclassified probably benign
IGL03022:Gtf2f1 APN 17 57010971 splice site probably null
IGL03094:Gtf2f1 APN 17 57007049 missense probably damaging 1.00
R0242:Gtf2f1 UTSW 17 57003802 missense probably benign 0.26
R0242:Gtf2f1 UTSW 17 57003802 missense probably benign 0.26
R0480:Gtf2f1 UTSW 17 57004307 critical splice donor site probably null
R2270:Gtf2f1 UTSW 17 57003462 missense probably null 0.00
R4209:Gtf2f1 UTSW 17 57011003 missense probably benign 0.01
R4637:Gtf2f1 UTSW 17 57004534 missense probably benign 0.20
R5102:Gtf2f1 UTSW 17 57003626 missense probably damaging 1.00
R5103:Gtf2f1 UTSW 17 57004519 missense probably damaging 0.97
R6167:Gtf2f1 UTSW 17 57004161 missense probably damaging 1.00
R6707:Gtf2f1 UTSW 17 57007770 missense probably benign 0.00
R7254:Gtf2f1 UTSW 17 57007101 missense possibly damaging 0.85
R7259:Gtf2f1 UTSW 17 57004562 missense probably damaging 0.96
R7307:Gtf2f1 UTSW 17 57007833 missense probably damaging 1.00
R7683:Gtf2f1 UTSW 17 57005458 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATACCACCTGTGACCAGTTTGGGG -3'
(R):5'- CCGAGGGACACAACGAAGTTCATC -3'

Sequencing Primer
(F):5'- gaaattctcttacatctgcttccc -3'
(R):5'- ACGAAGTTCATCCCGTCAGG -3'
Posted On2014-01-29