Incidental Mutation 'R1255:Aff3'
ID151402
Institutional Source Beutler Lab
Gene Symbol Aff3
Ensembl Gene ENSMUSG00000037138
Gene NameAF4/FMR2 family, member 3
SynonymsLaf4, LAF-4, 3222402O04Rik
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1255 (G1)
Quality Score120
Status Not validated
Chromosome1
Chromosomal Location38177326-38664955 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 38204884 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039827] [ENSMUST00000095027]
Predicted Effect probably null
Transcript: ENSMUST00000039827
SMART Domains Protein: ENSMUSP00000044128
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 20 170 4.9e-63 PFAM
Pfam:AF-4 160 1226 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000095027
SMART Domains Protein: ENSMUSP00000092637
Gene: ENSMUSG00000037138

DomainStartEndE-ValueType
Pfam:AF-4 20 172 1.7e-47 PFAM
Pfam:AF-4 161 1226 3.8e-268 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tissue-restricted nuclear transcriptional activator that is preferentially expressed in lymphoid tissue. Isolation of this protein initially defined a highly conserved LAF4/MLLT2 gene family of nuclear transcription factors that may function in lymphoid development and oncogenesis. In some ALL patients, this gene has been found fused to the gene for MLL. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsf3 T C 8: 122,785,966 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Atxn3 T A 12: 101,934,334 Q230L probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Dennd5b A T 6: 149,041,650 M576K possibly damaging Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gimap1 T A 6: 48,743,006 V184E probably benign Het
Gtf2f1 A G 17: 57,010,982 V18A probably damaging Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Nipal2 T C 15: 34,584,682 I247V probably benign Het
Olfr992 T A 2: 85,400,303 I77F probably damaging Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Slc47a1 A T 11: 61,370,148 L142Q probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Spz1 C A 13: 92,575,630 V113F probably benign Het
Tcn2 T C 11: 3,922,120 T336A probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1l T C 10: 89,745,270 I9T probably damaging Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Aff3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Aff3 APN 1 38535681 missense probably damaging 1.00
IGL02263:Aff3 APN 1 38535599 missense probably damaging 1.00
IGL02962:Aff3 APN 1 38535656 missense probably damaging 1.00
IGL03003:Aff3 APN 1 38209570 missense probably damaging 1.00
IGL03180:Aff3 APN 1 38535662 missense probably damaging 1.00
IGL03389:Aff3 APN 1 38210349 missense possibly damaging 0.62
PIT4377001:Aff3 UTSW 1 38538963 missense probably damaging 0.99
PIT4544001:Aff3 UTSW 1 38210362 missense probably benign 0.01
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0004:Aff3 UTSW 1 38269726 missense possibly damaging 0.46
R0026:Aff3 UTSW 1 38203893 missense probably benign 0.00
R0279:Aff3 UTSW 1 38535569 missense probably damaging 1.00
R0344:Aff3 UTSW 1 38203932 missense probably benign
R0375:Aff3 UTSW 1 38204940 missense possibly damaging 0.46
R0605:Aff3 UTSW 1 38209987 missense probably damaging 1.00
R0613:Aff3 UTSW 1 38209923 missense probably benign 0.09
R0742:Aff3 UTSW 1 38627108 missense probably damaging 0.99
R1156:Aff3 UTSW 1 38204910 missense probably benign
R1448:Aff3 UTSW 1 38191283 missense probably damaging 1.00
R1760:Aff3 UTSW 1 38329864 splice site probably benign
R1780:Aff3 UTSW 1 38535702 missense probably damaging 1.00
R1855:Aff3 UTSW 1 38210304 missense probably benign 0.23
R2011:Aff3 UTSW 1 38207915 missense probably benign 0.01
R2331:Aff3 UTSW 1 38204890 splice site probably null
R2965:Aff3 UTSW 1 38209710 missense probably damaging 1.00
R2970:Aff3 UTSW 1 38535022 missense probably damaging 0.97
R3015:Aff3 UTSW 1 38210568 missense probably benign 0.00
R3763:Aff3 UTSW 1 38252689 splice site probably benign
R4174:Aff3 UTSW 1 38207927 missense probably damaging 0.96
R4436:Aff3 UTSW 1 38209687 missense possibly damaging 0.75
R4661:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
R5069:Aff3 UTSW 1 38181613 critical splice donor site probably null
R5566:Aff3 UTSW 1 38181424 missense probably damaging 1.00
R6023:Aff3 UTSW 1 38218370 missense probably damaging 1.00
R6209:Aff3 UTSW 1 38193589 missense probably benign 0.28
R6467:Aff3 UTSW 1 38208017 missense probably benign 0.25
R6748:Aff3 UTSW 1 38535246 missense probably damaging 1.00
R6862:Aff3 UTSW 1 38406497 missense possibly damaging 0.87
R6880:Aff3 UTSW 1 38535162 missense probably damaging 0.99
R6880:Aff3 UTSW 1 38627128 missense possibly damaging 0.94
R7187:Aff3 UTSW 1 38218397 missense probably damaging 0.98
R8322:Aff3 UTSW 1 38181661 missense possibly damaging 0.65
Z1176:Aff3 UTSW 1 38329872 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATCAAGCTGAGGACTTCTGCAC -3'
(R):5'- ATGAAAAGATGCTCCGGTCGCC -3'

Sequencing Primer
(F):5'- tctctctctctccccccc -3'
(R):5'- CCACTTCGCCACTCTCAGAC -3'
Posted On2014-01-29