Incidental Mutation 'R1255:Tcn2'
ID151424
Institutional Source Beutler Lab
Gene Symbol Tcn2
Ensembl Gene ENSMUSG00000020432
Gene Nametranscobalamin 2
SynonymsTcn-2
MMRRC Submission 039322-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1255 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3917192-3932159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3922120 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 336 (T336A)
Ref Sequence ENSEMBL: ENSMUSP00000105620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020710] [ENSMUST00000109988] [ENSMUST00000109989] [ENSMUST00000109990] [ENSMUST00000109991] [ENSMUST00000109992] [ENSMUST00000109993]
Predicted Effect probably benign
Transcript: ENSMUST00000020710
AA Change: T336A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020710
Gene: ENSMUSG00000020432
AA Change: T336A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109988
AA Change: T336A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105615
Gene: ENSMUSG00000020432
AA Change: T336A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109989
AA Change: T336A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105616
Gene: ENSMUSG00000020432
AA Change: T336A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109990
AA Change: T336A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105617
Gene: ENSMUSG00000020432
AA Change: T336A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109991
AA Change: T336A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105618
Gene: ENSMUSG00000020432
AA Change: T336A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 3 331 1.2e-118 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 429 9.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109992
AA Change: T336A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105619
Gene: ENSMUSG00000020432
AA Change: T336A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109993
AA Change: T336A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105620
Gene: ENSMUSG00000020432
AA Change: T336A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This plasma protein binds cobalamin and mediates the transport of cobalamin into cells. This protein and other mammalian cobalamin-binding proteins, such as transcobalamin I and gastric intrisic factor, may have evolved by duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: This locus controls transcobalamin-2 electrophoretic variation. The s allele determines a slow band in serum from A/J, C57BL/6, BALB/c and C3H/He; the f allele determines faster form in NZB, ST/b and CPB-WV. Heterozygotes have both forms. Sequencing reveals a Gly to Glu substitution in NZB compared to BALB/c, DBA/2 and C57BL/6 (Genbank AF090686). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,793 S21C probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acsf3 T C 8: 122,785,966 probably null Het
Aff3 A T 1: 38,204,884 probably null Het
Antxr2 A T 5: 97,975,372 I272N probably benign Het
Asphd2 A C 5: 112,391,811 V52G probably damaging Het
Atxn3 T A 12: 101,934,334 Q230L probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Ciz1 T A 2: 32,365,876 probably null Het
Dennd5b A T 6: 149,041,650 M576K possibly damaging Het
Ebf3 C T 7: 137,225,212 V315I probably benign Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Gimap1 T A 6: 48,743,006 V184E probably benign Het
Gtf2f1 A G 17: 57,010,982 V18A probably damaging Het
Kcnn3 A T 3: 89,652,109 D562V possibly damaging Het
Kif20b A G 19: 34,950,106 T883A probably benign Het
Kmt2c A T 5: 25,351,153 L1198Q probably damaging Het
Nipal2 T C 15: 34,584,682 I247V probably benign Het
Olfr992 T A 2: 85,400,303 I77F probably damaging Het
Rad51ap2 G T 12: 11,458,094 K672N possibly damaging Het
Rbm28 C T 6: 29,158,247 G155D probably damaging Het
Sema6a A T 18: 47,249,299 M701K probably damaging Het
Slc47a1 A T 11: 61,370,148 L142Q probably damaging Het
Snx25 A T 8: 46,116,238 N207K probably benign Het
Son T A 16: 91,664,695 V205E probably damaging Het
Spz1 C A 13: 92,575,630 V113F probably benign Het
Tln1 T C 4: 43,538,044 D1852G probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1l T C 10: 89,745,270 I9T probably damaging Het
Zfp729a T C 13: 67,621,846 E88G probably benign Het
Other mutations in Tcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Tcn2 APN 11 3925072 missense probably benign
IGL02311:Tcn2 APN 11 3917692 missense probably damaging 1.00
IGL02614:Tcn2 APN 11 3926158 missense possibly damaging 0.91
IGL02655:Tcn2 APN 11 3926158 missense possibly damaging 0.91
IGL02679:Tcn2 APN 11 3927504 missense possibly damaging 0.93
IGL02752:Tcn2 APN 11 3926158 missense possibly damaging 0.91
R0265:Tcn2 UTSW 11 3922044 missense probably damaging 1.00
R0845:Tcn2 UTSW 11 3919349 missense probably benign
R1459:Tcn2 UTSW 11 3927516 missense probably benign 0.01
R1696:Tcn2 UTSW 11 3922169 missense probably damaging 1.00
R4209:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R4210:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R4211:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R5357:Tcn2 UTSW 11 3926017 missense possibly damaging 0.91
R5973:Tcn2 UTSW 11 3927546 nonsense probably null
R6973:Tcn2 UTSW 11 3917649 makesense probably null
R7479:Tcn2 UTSW 11 3917703 missense probably damaging 1.00
R8023:Tcn2 UTSW 11 3927579 missense possibly damaging 0.95
T0975:Tcn2 UTSW 11 3923487 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGATACCATTTCAAGCACGGAGGC -3'
(R):5'- GGACGTGACTTGAACAGATGCAGAC -3'

Sequencing Primer
(F):5'- GCCTGAGGGAAGTGAGAGC -3'
(R):5'- CATGCTGTTGACTGAGCTATTTC -3'
Posted On2014-01-29