Incidental Mutation 'R1235:Sema5a'
ID 152409
Institutional Source Beutler Lab
Gene Symbol Sema5a
Ensembl Gene ENSMUSG00000022231
Gene Name sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
Synonyms M-Sema D, semF, Semaf, 9130201M22Rik
MMRRC Submission 039303-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1235 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 32244959-32696487 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32609372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 426 (Y426F)
Ref Sequence ENSEMBL: ENSMUSP00000069024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067458]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067458
AA Change: Y426F

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000069024
Gene: ENSMUSG00000022231
AA Change: Y426F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 468 2.18e-173 SMART
PSI 486 533 1.78e-9 SMART
TSP1 543 597 2.23e-1 SMART
TSP1 598 651 2.05e-15 SMART
TSP1 656 702 6.94e-13 SMART
low complexity region 707 715 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
TSP1 787 839 4.17e-16 SMART
TSP1 844 896 9.08e-17 SMART
TSP1 899 946 3.19e-3 SMART
low complexity region 949 960 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228442
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for one null mutation die during organogenesis and display defects in branching of cranial vessels. Mice homozygous for another null mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arsg T C 11: 109,424,933 (GRCm39) probably null Het
Col6a1 C A 10: 76,548,158 (GRCm39) A633S unknown Het
Dnajb3 C T 1: 88,133,201 (GRCm39) R67H probably benign Het
Fam53c T A 18: 34,901,311 (GRCm39) L76Q probably damaging Het
Gys2 A T 6: 142,376,019 (GRCm39) Y548N probably damaging Het
Kcnh3 T A 15: 99,139,984 (GRCm39) probably null Het
Lrp2 C T 2: 69,354,380 (GRCm39) V483I probably damaging Het
Myom3 A T 4: 135,516,854 (GRCm39) Y808F probably benign Het
Nmur1 C T 1: 86,314,415 (GRCm39) G307S probably damaging Het
Or8w1 T G 2: 87,465,159 (GRCm39) probably null Het
Pcdhb13 T C 18: 37,578,012 (GRCm39) *797Q probably null Het
Plcb4 G A 2: 135,814,868 (GRCm39) G719R probably damaging Het
Pld1 A T 3: 28,082,883 (GRCm39) T143S probably benign Het
Rem1 G A 2: 152,476,455 (GRCm39) V238M probably damaging Het
Trpc7 G T 13: 57,035,352 (GRCm39) H194N probably damaging Het
Vmn2r106 A T 17: 20,499,741 (GRCm39) F165I probably benign Het
Zdbf2 A G 1: 63,348,232 (GRCm39) T2204A possibly damaging Het
Zp2 A T 7: 119,737,566 (GRCm39) F240I possibly damaging Het
Other mutations in Sema5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Sema5a APN 15 32,619,026 (GRCm39) missense probably benign 0.06
IGL01148:Sema5a APN 15 32,681,641 (GRCm39) missense probably benign 0.00
IGL01285:Sema5a APN 15 32,575,143 (GRCm39) missense possibly damaging 0.66
IGL01647:Sema5a APN 15 32,417,587 (GRCm39) missense possibly damaging 0.82
IGL01845:Sema5a APN 15 32,474,514 (GRCm39) splice site probably benign
IGL01970:Sema5a APN 15 32,686,792 (GRCm39) missense probably benign 0.02
IGL01986:Sema5a APN 15 32,682,506 (GRCm39) splice site probably benign
IGL02053:Sema5a APN 15 32,550,413 (GRCm39) missense probably benign 0.00
IGL02234:Sema5a APN 15 32,679,318 (GRCm39) missense probably damaging 1.00
IGL02325:Sema5a APN 15 32,686,977 (GRCm39) missense possibly damaging 0.63
IGL02370:Sema5a APN 15 32,682,445 (GRCm39) splice site probably benign
IGL02427:Sema5a APN 15 32,673,690 (GRCm39) splice site probably benign
IGL02621:Sema5a APN 15 32,538,802 (GRCm39) splice site probably benign
IGL02656:Sema5a APN 15 32,631,431 (GRCm39) missense possibly damaging 0.95
IGL03091:Sema5a APN 15 32,538,880 (GRCm39) splice site probably benign
IGL03107:Sema5a APN 15 32,669,554 (GRCm39) missense probably damaging 0.98
IGL03114:Sema5a APN 15 32,673,573 (GRCm39) missense probably damaging 0.99
IGL03222:Sema5a APN 15 32,628,304 (GRCm39) missense probably benign 0.32
PIT4305001:Sema5a UTSW 15 32,628,345 (GRCm39) missense probably benign
R0190:Sema5a UTSW 15 32,562,920 (GRCm39) missense possibly damaging 0.93
R0409:Sema5a UTSW 15 32,681,755 (GRCm39) missense probably damaging 1.00
R0413:Sema5a UTSW 15 32,669,590 (GRCm39) missense probably damaging 1.00
R0504:Sema5a UTSW 15 32,574,949 (GRCm39) splice site probably benign
R1484:Sema5a UTSW 15 32,460,431 (GRCm39) missense probably damaging 1.00
R1550:Sema5a UTSW 15 32,618,995 (GRCm39) missense probably benign 0.00
R1557:Sema5a UTSW 15 32,460,418 (GRCm39) missense probably benign 0.04
R1670:Sema5a UTSW 15 32,548,945 (GRCm39) missense probably damaging 1.00
R1688:Sema5a UTSW 15 32,669,570 (GRCm39) missense probably benign 0.01
R1760:Sema5a UTSW 15 32,641,252 (GRCm39) missense probably damaging 0.99
R1960:Sema5a UTSW 15 32,562,877 (GRCm39) missense possibly damaging 0.66
R1967:Sema5a UTSW 15 32,681,765 (GRCm39) missense probably damaging 0.99
R2062:Sema5a UTSW 15 32,609,363 (GRCm39) splice site probably benign
R2082:Sema5a UTSW 15 32,619,002 (GRCm39) missense probably benign 0.04
R2218:Sema5a UTSW 15 32,631,455 (GRCm39) missense probably damaging 0.99
R2267:Sema5a UTSW 15 32,575,065 (GRCm39) missense probably benign 0.03
R2299:Sema5a UTSW 15 32,562,922 (GRCm39) missense possibly damaging 0.95
R2438:Sema5a UTSW 15 32,550,399 (GRCm39) missense possibly damaging 0.63
R2698:Sema5a UTSW 15 32,673,546 (GRCm39) missense probably damaging 1.00
R3950:Sema5a UTSW 15 32,689,484 (GRCm39) missense probably damaging 1.00
R4197:Sema5a UTSW 15 32,619,064 (GRCm39) missense probably benign
R4496:Sema5a UTSW 15 32,641,133 (GRCm39) missense probably damaging 1.00
R4840:Sema5a UTSW 15 32,550,400 (GRCm39) missense possibly damaging 0.63
R4842:Sema5a UTSW 15 32,609,563 (GRCm39) missense probably benign
R4867:Sema5a UTSW 15 32,550,436 (GRCm39) missense possibly damaging 0.60
R4934:Sema5a UTSW 15 32,679,310 (GRCm39) missense probably damaging 1.00
R4977:Sema5a UTSW 15 32,679,332 (GRCm39) missense probably damaging 1.00
R5204:Sema5a UTSW 15 32,686,793 (GRCm39) missense probably benign 0.00
R5580:Sema5a UTSW 15 32,575,031 (GRCm39) missense probably benign 0.00
R5937:Sema5a UTSW 15 32,574,987 (GRCm39) missense probably damaging 1.00
R6220:Sema5a UTSW 15 32,686,875 (GRCm39) missense probably damaging 0.99
R6897:Sema5a UTSW 15 32,550,421 (GRCm39) missense probably benign 0.05
R7037:Sema5a UTSW 15 32,686,993 (GRCm39) missense probably damaging 1.00
R7072:Sema5a UTSW 15 32,575,105 (GRCm39) missense possibly damaging 0.94
R7273:Sema5a UTSW 15 32,417,608 (GRCm39) missense probably benign
R7572:Sema5a UTSW 15 32,673,574 (GRCm39) missense probably damaging 1.00
R7621:Sema5a UTSW 15 32,609,378 (GRCm39) missense possibly damaging 0.65
R7642:Sema5a UTSW 15 32,682,471 (GRCm39) missense probably damaging 0.97
R7870:Sema5a UTSW 15 32,609,485 (GRCm39) missense probably benign 0.23
R7880:Sema5a UTSW 15 32,686,954 (GRCm39) missense probably damaging 1.00
R8025:Sema5a UTSW 15 32,548,928 (GRCm39) missense probably benign 0.37
R8034:Sema5a UTSW 15 32,574,987 (GRCm39) missense probably damaging 1.00
R8241:Sema5a UTSW 15 32,575,064 (GRCm39) missense probably benign
R8539:Sema5a UTSW 15 32,618,989 (GRCm39) missense probably damaging 0.98
R8728:Sema5a UTSW 15 32,562,703 (GRCm39) missense probably damaging 0.98
R8807:Sema5a UTSW 15 32,562,868 (GRCm39) missense possibly damaging 0.83
R8825:Sema5a UTSW 15 32,689,498 (GRCm39) missense probably benign 0.02
R9109:Sema5a UTSW 15 32,619,040 (GRCm39) missense probably benign 0.02
R9235:Sema5a UTSW 15 32,619,034 (GRCm39) missense probably benign 0.01
R9298:Sema5a UTSW 15 32,619,040 (GRCm39) missense probably benign 0.02
R9354:Sema5a UTSW 15 32,562,902 (GRCm39) nonsense probably null
R9515:Sema5a UTSW 15 32,679,373 (GRCm39) missense probably damaging 1.00
R9663:Sema5a UTSW 15 32,673,546 (GRCm39) nonsense probably null
X0020:Sema5a UTSW 15 32,417,646 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAATGGGTAGCAATCACCACGC -3'
(R):5'- GTCCCACAAATAGGACACTCTGGC -3'

Sequencing Primer
(F):5'- gagttctcaccactggctac -3'
(R):5'- ACACTCTGGCTGTGGAGG -3'
Posted On 2014-01-29