Incidental Mutation 'R1550:Sema5a'
ID169871
Institutional Source Beutler Lab
Gene Symbol Sema5a
Ensembl Gene ENSMUSG00000022231
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
SynonymssemF, 9130201M22Rik, Semaf, M-Sema D
MMRRC Submission 039589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1550 (G1)
Quality Score176
Status Not validated
Chromosome15
Chromosomal Location32244810-32696341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32618849 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 508 (A508T)
Ref Sequence ENSEMBL: ENSMUSP00000069024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067458]
Predicted Effect probably benign
Transcript: ENSMUST00000067458
AA Change: A508T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069024
Gene: ENSMUSG00000022231
AA Change: A508T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 468 2.18e-173 SMART
PSI 486 533 1.78e-9 SMART
TSP1 543 597 2.23e-1 SMART
TSP1 598 651 2.05e-15 SMART
TSP1 656 702 6.94e-13 SMART
low complexity region 707 715 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
TSP1 787 839 4.17e-16 SMART
TSP1 844 896 9.08e-17 SMART
TSP1 899 946 3.19e-3 SMART
low complexity region 949 960 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228442
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for one null mutation die during organogenesis and display defects in branching of cranial vessels. Mice homozygous for another null mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abcc6 A G 7: 46,005,244 V551A probably benign Het
Acss1 A T 2: 150,642,795 L176Q probably damaging Het
Aldh7a1 A G 18: 56,550,382 I117T possibly damaging Het
Arf5 C T 6: 28,426,153 R180C probably damaging Het
Arhgap21 A T 2: 20,881,765 Y39* probably null Het
Arrdc1 A G 2: 24,926,339 L206P probably damaging Het
Cby3 A T 11: 50,359,486 Y173F probably damaging Het
Cdh18 T A 15: 23,436,548 C497S probably damaging Het
Cyp11b2 T C 15: 74,853,593 I226V probably benign Het
Ddit4l T A 3: 137,624,275 probably null Het
Ddx11 C T 17: 66,138,220 T405I probably benign Het
Dhx40 A T 11: 86,776,739 probably null Het
Dlgap2 A G 8: 14,822,499 D659G probably damaging Het
Eef2 A G 10: 81,180,847 E586G probably benign Het
Fam161a A G 11: 23,020,470 Q216R possibly damaging Het
Fbxw24 G T 9: 109,607,044 R307S probably benign Het
Gbp2b G T 3: 142,606,830 A325S probably damaging Het
Gli1 A T 10: 127,338,516 F2Y probably damaging Het
Gm7075 A G 10: 63,421,648 L31P probably damaging Het
Gnl2 T C 4: 125,044,234 V269A probably damaging Het
Grin1 A G 2: 25,305,131 V292A probably benign Het
Heg1 T A 16: 33,735,553 V1001E probably damaging Het
Herc2 T A 7: 56,135,658 I1552N probably damaging Het
Htr1a A G 13: 105,445,280 T343A probably benign Het
Itk G T 11: 46,389,326 R29S probably damaging Het
Ivns1abp G T 1: 151,361,491 G469C probably damaging Het
Jph3 A T 8: 121,784,859 N529Y possibly damaging Het
Kdm2b A G 5: 122,881,057 L829P probably damaging Het
Kprp T A 3: 92,824,726 Y339F probably damaging Het
Lrp2 A G 2: 69,502,661 V1504A possibly damaging Het
Lypd6b A G 2: 49,943,603 D85G probably damaging Het
Mansc4 T C 6: 147,075,638 Y160C probably damaging Het
Mgll C A 6: 88,813,889 H164N probably benign Het
Mtmr4 A T 11: 87,613,516 D1097V probably damaging Het
Nfasc T C 1: 132,608,503 K571E probably damaging Het
Nfat5 A T 8: 107,370,573 N1527Y probably damaging Het
Nlgn1 A G 3: 25,912,644 L215P probably damaging Het
Olfr6 T A 7: 106,956,028 I303L probably benign Het
Pde4dip T C 3: 97,719,704 S1173G probably damaging Het
Prrt3 A T 6: 113,495,507 V568E probably damaging Het
Ptpra G A 2: 130,541,393 R503Q possibly damaging Het
Serpinb11 T C 1: 107,379,688 I283T possibly damaging Het
Setbp1 A T 18: 78,858,592 L620Q probably damaging Het
Sipa1l3 A T 7: 29,383,203 C756S probably benign Het
Sirpa A T 2: 129,630,041 I463F probably damaging Het
Slc13a2 G T 11: 78,403,164 N257K probably damaging Het
Slc4a5 C A 6: 83,271,057 T530N probably damaging Het
Stab2 A T 10: 86,878,926 F125L probably benign Het
Tet2 G T 3: 133,469,519 Q1356K probably benign Het
Tet3 A T 6: 83,386,028 S856T probably damaging Het
Tg C T 15: 66,693,430 T1207I possibly damaging Het
Tkt A G 14: 30,565,568 Y173C probably damaging Het
Tlr6 T A 5: 64,953,411 I718F probably damaging Het
Tnfrsf11b A G 15: 54,254,058 V267A possibly damaging Het
Ubqln3 T A 7: 104,141,546 N446Y probably damaging Het
Vmn2r118 C T 17: 55,608,083 C521Y probably damaging Het
Vps16 A G 2: 130,440,340 D394G probably benign Het
Zfp236 A T 18: 82,674,424 M142K possibly damaging Het
Zfp780b T C 7: 27,964,857 D91G probably benign Het
Zfp97 T A 17: 17,145,206 Y322* probably null Het
Other mutations in Sema5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Sema5a APN 15 32618880 missense probably benign 0.06
IGL01148:Sema5a APN 15 32681495 missense probably benign 0.00
IGL01285:Sema5a APN 15 32574997 missense possibly damaging 0.66
IGL01647:Sema5a APN 15 32417441 missense possibly damaging 0.82
IGL01845:Sema5a APN 15 32474368 splice site probably benign
IGL01970:Sema5a APN 15 32686646 missense probably benign 0.02
IGL01986:Sema5a APN 15 32682360 splice site probably benign
IGL02053:Sema5a APN 15 32550267 missense probably benign 0.00
IGL02234:Sema5a APN 15 32679172 missense probably damaging 1.00
IGL02325:Sema5a APN 15 32686831 missense possibly damaging 0.63
IGL02370:Sema5a APN 15 32682299 splice site probably benign
IGL02427:Sema5a APN 15 32673544 splice site probably benign
IGL02621:Sema5a APN 15 32538656 splice site probably benign
IGL02656:Sema5a APN 15 32631285 missense possibly damaging 0.95
IGL03091:Sema5a APN 15 32538734 splice site probably benign
IGL03107:Sema5a APN 15 32669408 missense probably damaging 0.98
IGL03114:Sema5a APN 15 32673427 missense probably damaging 0.99
IGL03222:Sema5a APN 15 32628158 missense probably benign 0.32
PIT4305001:Sema5a UTSW 15 32628199 missense probably benign
R0190:Sema5a UTSW 15 32562774 missense possibly damaging 0.93
R0409:Sema5a UTSW 15 32681609 missense probably damaging 1.00
R0413:Sema5a UTSW 15 32669444 missense probably damaging 1.00
R0504:Sema5a UTSW 15 32574803 splice site probably benign
R1235:Sema5a UTSW 15 32609226 missense probably benign 0.04
R1484:Sema5a UTSW 15 32460285 missense probably damaging 1.00
R1557:Sema5a UTSW 15 32460272 missense probably benign 0.04
R1670:Sema5a UTSW 15 32548799 missense probably damaging 1.00
R1688:Sema5a UTSW 15 32669424 missense probably benign 0.01
R1760:Sema5a UTSW 15 32641106 missense probably damaging 0.99
R1960:Sema5a UTSW 15 32562731 missense possibly damaging 0.66
R1967:Sema5a UTSW 15 32681619 missense probably damaging 0.99
R2062:Sema5a UTSW 15 32609217 splice site probably benign
R2082:Sema5a UTSW 15 32618856 missense probably benign 0.04
R2218:Sema5a UTSW 15 32631309 missense probably damaging 0.99
R2267:Sema5a UTSW 15 32574919 missense probably benign 0.03
R2299:Sema5a UTSW 15 32562776 missense possibly damaging 0.95
R2438:Sema5a UTSW 15 32550253 missense possibly damaging 0.63
R2698:Sema5a UTSW 15 32673400 missense probably damaging 1.00
R3950:Sema5a UTSW 15 32689338 missense probably damaging 1.00
R4197:Sema5a UTSW 15 32618918 missense probably benign
R4496:Sema5a UTSW 15 32640987 missense probably damaging 1.00
R4840:Sema5a UTSW 15 32550254 missense possibly damaging 0.63
R4842:Sema5a UTSW 15 32609417 missense probably benign
R4867:Sema5a UTSW 15 32550290 missense possibly damaging 0.60
R4934:Sema5a UTSW 15 32679164 missense probably damaging 1.00
R4977:Sema5a UTSW 15 32679186 missense probably damaging 1.00
R5204:Sema5a UTSW 15 32686647 missense probably benign 0.00
R5580:Sema5a UTSW 15 32574885 missense probably benign 0.00
R5937:Sema5a UTSW 15 32574841 missense probably damaging 1.00
R6220:Sema5a UTSW 15 32686729 missense probably damaging 0.99
R6897:Sema5a UTSW 15 32550275 missense probably benign 0.05
R7037:Sema5a UTSW 15 32686847 missense probably damaging 1.00
R7072:Sema5a UTSW 15 32574959 missense possibly damaging 0.94
R7273:Sema5a UTSW 15 32417462 missense probably benign
R7572:Sema5a UTSW 15 32673428 missense probably damaging 1.00
R7621:Sema5a UTSW 15 32609232 missense possibly damaging 0.65
R7642:Sema5a UTSW 15 32682325 missense probably damaging 0.97
R7870:Sema5a UTSW 15 32609339 missense probably benign 0.23
R7880:Sema5a UTSW 15 32686808 missense probably damaging 1.00
R8025:Sema5a UTSW 15 32548782 missense probably benign 0.37
R8034:Sema5a UTSW 15 32574841 missense probably damaging 1.00
R8241:Sema5a UTSW 15 32574918 missense probably benign
R8539:Sema5a UTSW 15 32618843 missense probably damaging 0.98
R8728:Sema5a UTSW 15 32562557 missense probably damaging 0.98
R8807:Sema5a UTSW 15 32562722 missense possibly damaging 0.83
R8825:Sema5a UTSW 15 32689352 missense probably benign 0.02
X0020:Sema5a UTSW 15 32417500 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGTGAACAATGACTCCTTGCCC -3'
(R):5'- TGGTCCTCCTACAAGCCAGGAATAG -3'

Sequencing Primer
(F):5'- CAGTTCCAGTGTTATCACAGCAAG -3'
(R):5'- TCCTACAAGCCAGGAATAGATCAAG -3'
Posted On2014-04-13