Incidental Mutation 'R1224:Cd46'
ID 152824
Institutional Source Beutler Lab
Gene Symbol Cd46
Ensembl Gene ENSMUSG00000016493
Gene Name CD46 antigen, complement regulatory protein
Synonyms CD46, Mcp
MMRRC Submission 039293-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1224 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 194719134-194774557 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 194744706 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 344 (I344K)
Ref Sequence ENSEMBL: ENSMUSP00000123931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159563] [ENSMUST00000162650]
AlphaFold O88174
Predicted Effect probably benign
Transcript: ENSMUST00000159563
SMART Domains Protein: ENSMUSP00000123901
Gene: ENSMUSG00000016493

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161772
Predicted Effect possibly damaging
Transcript: ENSMUST00000162650
AA Change: I344K

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123931
Gene: ENSMUSG00000016493
AA Change: I344K

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
CCP 45 104 6.7e-3 SMART
CCP 109 168 3.87e-8 SMART
CCP 173 234 2.14e-10 SMART
CCP 239 294 1.06e-14 SMART
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162951
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased litter sizes sired by mutant males. Another homozygous null mouse shows increased susceptibility to induced choroid neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T A 11: 109,931,408 (GRCm39) E1248D probably damaging Het
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Aldh16a1 T C 7: 44,791,471 (GRCm39) probably null Het
Aldh9a1 T A 1: 167,180,227 (GRCm39) I107N probably damaging Het
Atp6ap1l G A 13: 91,034,675 (GRCm39) Q236* probably null Het
Ccdc39 T C 3: 33,880,629 (GRCm39) K446R probably damaging Het
Ces3a A T 8: 105,778,141 (GRCm39) D204V probably damaging Het
Clstn3 T C 6: 124,434,878 (GRCm39) S346G probably benign Het
Cplane1 T A 15: 8,207,869 (GRCm39) C207S probably benign Het
Dock1 A G 7: 134,710,548 (GRCm39) D1190G possibly damaging Het
Gimap8 G A 6: 48,627,629 (GRCm39) S201N probably benign Het
Gm10153 A G 7: 141,744,072 (GRCm39) S19P unknown Het
Igfn1 A G 1: 135,897,494 (GRCm39) V1024A probably benign Het
Kcng3 A G 17: 83,938,824 (GRCm39) L75P probably damaging Het
Krt31 C T 11: 99,940,690 (GRCm39) probably null Het
Ly6a A G 15: 74,868,327 (GRCm39) V54A possibly damaging Het
Map3k7cl T A 16: 87,352,891 (GRCm39) D21E probably benign Het
Or8g18 G C 9: 39,149,547 (GRCm39) P58A probably benign Het
Rapsn T C 2: 90,873,543 (GRCm39) L230P probably damaging Het
Rhog C A 7: 101,888,959 (GRCm39) V165F possibly damaging Het
Slc44a4 T C 17: 35,140,844 (GRCm39) V313A probably benign Het
Sox14 G C 9: 99,757,168 (GRCm39) H190Q probably damaging Het
Sval2 G A 6: 41,841,188 (GRCm39) D103N probably benign Het
Tm9sf3 A T 19: 41,211,634 (GRCm39) V403D probably damaging Het
Tmem269 T C 4: 119,074,323 (GRCm39) K18R probably benign Het
Unc80 T C 1: 66,511,139 (GRCm39) F49S probably damaging Het
Zdhhc7 T A 8: 120,809,311 (GRCm39) T299S probably benign Het
Zfp52 T C 17: 21,775,324 (GRCm39) V6A possibly damaging Het
Other mutations in Cd46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02429:Cd46 APN 1 194,767,732 (GRCm39) missense probably benign 0.01
IGL03029:Cd46 APN 1 194,768,451 (GRCm39) missense probably benign 0.43
R0269:Cd46 UTSW 1 194,746,996 (GRCm39) missense probably benign 0.00
R0375:Cd46 UTSW 1 194,768,472 (GRCm39) missense probably benign 0.00
R0627:Cd46 UTSW 1 194,774,494 (GRCm39) missense probably benign 0.03
R0784:Cd46 UTSW 1 194,774,502 (GRCm39) missense possibly damaging 0.96
R0892:Cd46 UTSW 1 194,764,920 (GRCm39) missense possibly damaging 0.78
R0973:Cd46 UTSW 1 194,724,300 (GRCm39) makesense probably null
R0973:Cd46 UTSW 1 194,724,300 (GRCm39) makesense probably null
R0974:Cd46 UTSW 1 194,724,300 (GRCm39) makesense probably null
R1716:Cd46 UTSW 1 194,760,117 (GRCm39) missense probably benign 0.21
R1863:Cd46 UTSW 1 194,765,931 (GRCm39) missense probably damaging 1.00
R2000:Cd46 UTSW 1 194,760,012 (GRCm39) missense probably benign 0.00
R2152:Cd46 UTSW 1 194,744,721 (GRCm39) missense probably benign 0.42
R2153:Cd46 UTSW 1 194,744,721 (GRCm39) missense probably benign 0.42
R4452:Cd46 UTSW 1 194,767,668 (GRCm39) missense possibly damaging 0.84
R4860:Cd46 UTSW 1 194,744,704 (GRCm39) missense possibly damaging 0.94
R4860:Cd46 UTSW 1 194,744,704 (GRCm39) missense possibly damaging 0.94
R4934:Cd46 UTSW 1 194,765,107 (GRCm39) intron probably benign
R5156:Cd46 UTSW 1 194,767,693 (GRCm39) missense possibly damaging 0.90
R5287:Cd46 UTSW 1 194,744,719 (GRCm39) missense possibly damaging 0.65
R5303:Cd46 UTSW 1 194,744,707 (GRCm39) missense probably benign
R5403:Cd46 UTSW 1 194,744,719 (GRCm39) missense possibly damaging 0.65
R5487:Cd46 UTSW 1 194,750,478 (GRCm39) critical splice acceptor site probably null
R5505:Cd46 UTSW 1 194,767,688 (GRCm39) missense possibly damaging 0.88
R5538:Cd46 UTSW 1 194,750,478 (GRCm39) critical splice acceptor site probably null
R6721:Cd46 UTSW 1 194,765,939 (GRCm39) missense probably damaging 1.00
R6731:Cd46 UTSW 1 194,765,775 (GRCm39) splice site probably null
R7226:Cd46 UTSW 1 194,724,314 (GRCm39) missense possibly damaging 0.84
R7633:Cd46 UTSW 1 194,765,927 (GRCm39) missense probably null 0.01
R8277:Cd46 UTSW 1 194,747,030 (GRCm39) missense probably damaging 0.96
R8672:Cd46 UTSW 1 194,764,949 (GRCm39) missense probably benign 0.09
R9153:Cd46 UTSW 1 194,774,479 (GRCm39) missense possibly damaging 0.88
R9435:Cd46 UTSW 1 194,767,720 (GRCm39) missense probably damaging 0.99
R9455:Cd46 UTSW 1 194,744,704 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCTTCTTACCACCAGTCAAGTTAGACA -3'
(R):5'- TCTCAGAGTGGCccagaggtaatg -3'

Sequencing Primer
(F):5'- CACAGATCCTTATGCTGCAATG -3'
(R):5'- ccaggacagccagagaaac -3'
Posted On 2014-01-29