Incidental Mutation 'R1329:Usp4'
ID156121
Institutional Source Beutler Lab
Gene Symbol Usp4
Ensembl Gene ENSMUSG00000032612
Gene Nameubiquitin specific peptidase 4 (proto-oncogene)
SynonymsF730026I20Rik, Unp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R1329 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108347853-108392545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108372566 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 431 (V431E)
Ref Sequence ENSEMBL: ENSMUSP00000141321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035237] [ENSMUST00000194224] [ENSMUST00000194959]
Predicted Effect probably damaging
Transcript: ENSMUST00000035237
AA Change: V431E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035237
Gene: ENSMUSG00000032612
AA Change: V431E

DomainStartEndE-ValueType
DUSP 27 125 1.39e-46 SMART
Pfam:Ubiquitin_3 139 226 6.7e-34 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 919 2.2e-84 PFAM
Pfam:UCH_1 302 507 2.8e-8 PFAM
Pfam:UCH_1 605 901 1.4e-15 PFAM
low complexity region 927 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194065
Predicted Effect probably damaging
Transcript: ENSMUST00000194224
AA Change: V431E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141321
Gene: ENSMUSG00000032612
AA Change: V431E

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.3e-30 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 633 1.4e-50 PFAM
Pfam:UCH_1 302 520 2.3e-8 PFAM
low complexity region 657 673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194959
AA Change: V384E

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141368
Gene: ENSMUSG00000032612
AA Change: V384E

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.7e-30 PFAM
Pfam:UCH 254 872 7e-89 PFAM
Pfam:UCH_1 255 469 3.5e-8 PFAM
Pfam:UCH_1 566 854 2.5e-14 PFAM
low complexity region 880 891 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased irradiation-induced apoptosis, slow cellular growth, resistance to oncogenic transformation, and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T A 11: 29,823,553 N635Y probably benign Het
Acot7 C T 4: 152,229,784 Q188* probably null Het
Ano5 T C 7: 51,546,785 Y141H probably benign Het
Atg101 G A 15: 101,290,290 G92D probably null Het
Brwd1 A G 16: 96,003,234 I1912T probably benign Het
C530008M17Rik A G 5: 76,657,932 probably benign Het
Cad G T 5: 31,059,582 G263W probably damaging Het
Clstn2 T C 9: 97,458,174 E715G probably damaging Het
Dbp C T 7: 45,708,328 P70S probably damaging Het
Gpr61 T A 3: 108,150,514 H277L probably benign Het
Gsdma3 G T 11: 98,632,392 V203F probably damaging Het
Ifih1 G C 2: 62,617,487 probably null Het
Myo1e T A 9: 70,338,738 C404S possibly damaging Het
Myrfl A G 10: 116,777,342 probably null Het
Nfat5 T G 8: 107,369,027 M1300R probably benign Het
Nfrkb C T 9: 31,414,647 P1129S possibly damaging Het
Nubp2 A T 17: 24,883,864 N208K possibly damaging Het
Olfr44 A G 9: 39,484,444 S270P probably damaging Het
Ovch2 T C 7: 107,785,446 D488G probably damaging Het
Rfx6 A T 10: 51,693,737 Y202F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Vil1 A G 1: 74,427,558 I636V probably benign Het
Vmn2r116 A G 17: 23,387,188 N358S possibly damaging Het
Wdr47 T A 3: 108,627,299 N511K probably benign Het
Wdr5 T A 2: 27,531,671 F222I probably damaging Het
Other mutations in Usp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Usp4 APN 9 108362900 critical splice donor site probably null
IGL01663:Usp4 APN 9 108365880 missense possibly damaging 0.80
IGL02105:Usp4 APN 9 108384932 missense probably damaging 1.00
IGL02486:Usp4 APN 9 108351029 missense probably damaging 1.00
R0148:Usp4 UTSW 9 108391671 splice site probably null
R0285:Usp4 UTSW 9 108378564 missense probably benign 0.33
R0591:Usp4 UTSW 9 108348029 splice site probably benign
R0594:Usp4 UTSW 9 108370881 intron probably null
R0616:Usp4 UTSW 9 108366804 missense probably benign
R1508:Usp4 UTSW 9 108372674 missense probably benign 0.14
R1752:Usp4 UTSW 9 108374242 missense probably damaging 1.00
R1824:Usp4 UTSW 9 108348008 missense probably damaging 1.00
R1846:Usp4 UTSW 9 108372736 missense probably benign
R2196:Usp4 UTSW 9 108373686 missense probably benign 0.07
R2925:Usp4 UTSW 9 108367856 missense probably damaging 1.00
R4126:Usp4 UTSW 9 108360117 missense probably benign 0.10
R4345:Usp4 UTSW 9 108368023 intron probably benign
R4965:Usp4 UTSW 9 108362620 missense probably damaging 1.00
R4981:Usp4 UTSW 9 108381418 missense probably benign 0.00
R5110:Usp4 UTSW 9 108362678 missense probably damaging 1.00
R5580:Usp4 UTSW 9 108365859 missense probably benign 0.09
R5586:Usp4 UTSW 9 108356462 missense possibly damaging 0.95
R5927:Usp4 UTSW 9 108391760 missense probably benign 0.09
R6025:Usp4 UTSW 9 108360123 missense possibly damaging 0.70
R6112:Usp4 UTSW 9 108356504 missense probably damaging 1.00
R6197:Usp4 UTSW 9 108370955 missense probably damaging 1.00
R6742:Usp4 UTSW 9 108374239 missense possibly damaging 0.74
R7320:Usp4 UTSW 9 108388306 missense probably benign 0.00
R7458:Usp4 UTSW 9 108367856 missense probably damaging 1.00
R7531:Usp4 UTSW 9 108372680 missense probably damaging 1.00
R7563:Usp4 UTSW 9 108379344 missense probably benign
R8022:Usp4 UTSW 9 108378471 missense probably damaging 0.99
X0026:Usp4 UTSW 9 108347870 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCCTTTGGTGCTCTCAGAATC -3'
(R):5'- CCATGCAGCAGATAGAACGTAGTCC -3'

Sequencing Primer
(F):5'- TCAGAATCCCTTTTTTGCCATAG -3'
(R):5'- CAGATAGAACGTAGTCCCATCTGG -3'
Posted On2014-02-11