Incidental Mutation 'R5927:Usp4'
ID459957
Institutional Source Beutler Lab
Gene Symbol Usp4
Ensembl Gene ENSMUSG00000032612
Gene Nameubiquitin specific peptidase 4 (proto-oncogene)
SynonymsF730026I20Rik, Unp
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108347853-108392545 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 108391760 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 891 (S891A)
Ref Sequence ENSEMBL: ENSMUSP00000141368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035234] [ENSMUST00000035237] [ENSMUST00000192995] [ENSMUST00000194959]
Predicted Effect probably benign
Transcript: ENSMUST00000035234
Predicted Effect probably benign
Transcript: ENSMUST00000035237
AA Change: S938A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035237
Gene: ENSMUSG00000032612
AA Change: S938A

DomainStartEndE-ValueType
DUSP 27 125 1.39e-46 SMART
Pfam:Ubiquitin_3 139 226 6.7e-34 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 919 2.2e-84 PFAM
Pfam:UCH_1 302 507 2.8e-8 PFAM
Pfam:UCH_1 605 901 1.4e-15 PFAM
low complexity region 927 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192995
Predicted Effect probably benign
Transcript: ENSMUST00000193288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194939
Predicted Effect probably benign
Transcript: ENSMUST00000194959
AA Change: S891A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141368
Gene: ENSMUSG00000032612
AA Change: S891A

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.7e-30 PFAM
Pfam:UCH 254 872 7e-89 PFAM
Pfam:UCH_1 255 469 3.5e-8 PFAM
Pfam:UCH_1 566 854 2.5e-14 PFAM
low complexity region 880 891 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195351
Predicted Effect probably benign
Transcript: ENSMUST00000195608
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased irradiation-induced apoptosis, slow cellular growth, resistance to oncogenic transformation, and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Usp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Usp4 APN 9 108362900 critical splice donor site probably null
IGL01663:Usp4 APN 9 108365880 missense possibly damaging 0.80
IGL02105:Usp4 APN 9 108384932 missense probably damaging 1.00
IGL02486:Usp4 APN 9 108351029 missense probably damaging 1.00
R0148:Usp4 UTSW 9 108391671 splice site probably null
R0285:Usp4 UTSW 9 108378564 missense probably benign 0.33
R0591:Usp4 UTSW 9 108348029 splice site probably benign
R0594:Usp4 UTSW 9 108370881 intron probably null
R0616:Usp4 UTSW 9 108366804 missense probably benign
R1329:Usp4 UTSW 9 108372566 missense probably damaging 1.00
R1508:Usp4 UTSW 9 108372674 missense probably benign 0.14
R1752:Usp4 UTSW 9 108374242 missense probably damaging 1.00
R1824:Usp4 UTSW 9 108348008 missense probably damaging 1.00
R1846:Usp4 UTSW 9 108372736 missense probably benign
R2196:Usp4 UTSW 9 108373686 missense probably benign 0.07
R2925:Usp4 UTSW 9 108367856 missense probably damaging 1.00
R4126:Usp4 UTSW 9 108360117 missense probably benign 0.10
R4345:Usp4 UTSW 9 108368023 intron probably benign
R4965:Usp4 UTSW 9 108362620 missense probably damaging 1.00
R4981:Usp4 UTSW 9 108381418 missense probably benign 0.00
R5110:Usp4 UTSW 9 108362678 missense probably damaging 1.00
R5580:Usp4 UTSW 9 108365859 missense probably benign 0.09
R5586:Usp4 UTSW 9 108356462 missense possibly damaging 0.95
R6025:Usp4 UTSW 9 108360123 missense possibly damaging 0.70
R6112:Usp4 UTSW 9 108356504 missense probably damaging 1.00
R6197:Usp4 UTSW 9 108370955 missense probably damaging 1.00
R6742:Usp4 UTSW 9 108374239 missense possibly damaging 0.74
R7320:Usp4 UTSW 9 108388306 missense probably benign 0.00
R7458:Usp4 UTSW 9 108367856 missense probably damaging 1.00
R7531:Usp4 UTSW 9 108372680 missense probably damaging 1.00
R7563:Usp4 UTSW 9 108379344 missense probably benign
R8022:Usp4 UTSW 9 108378471 missense probably damaging 0.99
X0026:Usp4 UTSW 9 108347870 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCCCACATTCAGTTTAAGATTGC -3'
(R):5'- AATGTCCTCATCTGGTTTGAGATTG -3'

Sequencing Primer
(F):5'- CTTGGAAAAAGAATCCTCCTGTCAGG -3'
(R):5'- GAGATTGATATGAGCAGTCTTCAAG -3'
Posted On2017-02-28