Incidental Mutation 'R0591:Usp4'
ID55985
Institutional Source Beutler Lab
Gene Symbol Usp4
Ensembl Gene ENSMUSG00000032612
Gene Nameubiquitin specific peptidase 4 (proto-oncogene)
SynonymsF730026I20Rik, Unp
MMRRC Submission 038781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R0591 (G1)
Quality Score91
Status Validated
Chromosome9
Chromosomal Location108347853-108392545 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 108348029 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035237] [ENSMUST00000194224] [ENSMUST00000194959]
Predicted Effect probably benign
Transcript: ENSMUST00000035237
SMART Domains Protein: ENSMUSP00000035237
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 1.39e-46 SMART
Pfam:Ubiquitin_3 139 226 6.7e-34 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 919 2.2e-84 PFAM
Pfam:UCH_1 302 507 2.8e-8 PFAM
Pfam:UCH_1 605 901 1.4e-15 PFAM
low complexity region 927 938 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193093
Predicted Effect probably benign
Transcript: ENSMUST00000194224
SMART Domains Protein: ENSMUSP00000141321
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.3e-30 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:UCH 301 633 1.4e-50 PFAM
Pfam:UCH_1 302 520 2.3e-8 PFAM
low complexity region 657 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194959
SMART Domains Protein: ENSMUSP00000141368
Gene: ENSMUSG00000032612

DomainStartEndE-ValueType
DUSP 27 125 5.5e-49 SMART
Pfam:Ubiquitin_3 139 226 1.7e-30 PFAM
Pfam:UCH 254 872 7e-89 PFAM
Pfam:UCH_1 255 469 3.5e-8 PFAM
Pfam:UCH_1 566 854 2.5e-14 PFAM
low complexity region 880 891 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.7%
  • 20x: 95.3%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased irradiation-induced apoptosis, slow cellular growth, resistance to oncogenic transformation, and early cellular replicative senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,068,943 E1298* probably null Het
Adam19 T C 11: 46,121,411 probably benign Het
Agt A T 8: 124,556,939 S480R possibly damaging Het
Anapc1 G T 2: 128,619,332 D1769E probably benign Het
Aox4 T C 1: 58,239,102 probably benign Het
Apol9b G A 15: 77,735,630 V209I possibly damaging Het
Appl2 A T 10: 83,624,645 I116K possibly damaging Het
B230118H07Rik A T 2: 101,576,117 D155E probably benign Het
BC051665 A G 13: 60,784,608 probably benign Het
Cactin G T 10: 81,324,003 E89* probably null Het
Carf G T 1: 60,125,914 probably benign Het
Ccdc167 A G 17: 29,705,261 probably benign Het
Ceacam3 G A 7: 17,151,883 probably null Het
Clca4b T A 3: 144,915,592 K574* probably null Het
Crabp1 T A 9: 54,765,603 I64N probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dglucy T C 12: 100,859,518 probably benign Het
Dock10 C T 1: 80,541,219 probably benign Het
Ednrb A T 14: 103,823,274 probably null Het
Ercc6 T C 14: 32,558,016 probably benign Het
Gm5538 C A 3: 59,752,129 Y334* probably null Het
Golga3 A C 5: 110,188,743 Q416P probably damaging Het
Gpr12 A G 5: 146,583,635 V159A probably benign Het
Heatr5a A T 12: 51,910,101 probably benign Het
Helz2 A G 2: 181,232,116 I2195T probably damaging Het
Hikeshi A T 7: 89,920,087 N76K possibly damaging Het
Hsd11b1 T C 1: 193,229,676 probably benign Het
Inhba A T 13: 16,026,820 K322N probably damaging Het
Katnal1 A T 5: 148,892,516 F291L probably damaging Het
Kcnj9 T C 1: 172,323,098 E316G probably damaging Het
Lrsam1 A G 2: 32,933,923 probably benign Het
Mcf2l T G 8: 13,018,751 S1075A probably benign Het
Mios T C 6: 8,215,470 V222A possibly damaging Het
Mycbp2 A T 14: 103,196,391 probably benign Het
Nars A T 18: 64,500,567 I544N probably damaging Het
Olfr993 A G 2: 85,414,690 L63P possibly damaging Het
Pbrm1 A G 14: 31,046,430 probably benign Het
Plcb4 A G 2: 135,955,012 probably benign Het
Pnliprp1 A G 19: 58,734,706 D213G probably damaging Het
Psap A G 10: 60,300,855 N538D possibly damaging Het
Ptdss1 A G 13: 66,972,650 probably benign Het
Rap1b G A 10: 117,818,617 probably benign Het
Rhcg T A 7: 79,594,772 probably benign Het
Ryr1 G A 7: 29,104,795 T550I possibly damaging Het
Samm50 G A 15: 84,211,168 G452R probably benign Het
Scin A G 12: 40,080,930 probably null Het
Sesn3 T C 9: 14,308,558 L81S probably damaging Het
Skint6 A C 4: 112,858,169 probably benign Het
Slc30a4 A T 2: 122,685,240 L411H probably damaging Het
Slc44a5 C T 3: 154,234,145 probably benign Het
Slc4a3 C T 1: 75,549,021 A255V probably damaging Het
Slc9b1 A G 3: 135,382,832 N318S possibly damaging Het
Tcp11l2 A T 10: 84,604,594 H287L probably benign Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tnks2 T A 19: 36,872,562 Y605N probably damaging Het
Topbp1 T A 9: 103,349,838 N1490K probably benign Het
Ube4b T G 4: 149,357,577 probably benign Het
Vezf1 A T 11: 88,068,435 probably benign Het
Vmn1r184 A T 7: 26,267,075 D82V probably damaging Het
Other mutations in Usp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Usp4 APN 9 108362900 critical splice donor site probably null
IGL01663:Usp4 APN 9 108365880 missense possibly damaging 0.80
IGL02105:Usp4 APN 9 108384932 missense probably damaging 1.00
IGL02486:Usp4 APN 9 108351029 missense probably damaging 1.00
R0148:Usp4 UTSW 9 108391671 splice site probably null
R0285:Usp4 UTSW 9 108378564 missense probably benign 0.33
R0594:Usp4 UTSW 9 108370881 intron probably null
R0616:Usp4 UTSW 9 108366804 missense probably benign
R1329:Usp4 UTSW 9 108372566 missense probably damaging 1.00
R1508:Usp4 UTSW 9 108372674 missense probably benign 0.14
R1752:Usp4 UTSW 9 108374242 missense probably damaging 1.00
R1824:Usp4 UTSW 9 108348008 missense probably damaging 1.00
R1846:Usp4 UTSW 9 108372736 missense probably benign
R2196:Usp4 UTSW 9 108373686 missense probably benign 0.07
R2925:Usp4 UTSW 9 108367856 missense probably damaging 1.00
R4126:Usp4 UTSW 9 108360117 missense probably benign 0.10
R4345:Usp4 UTSW 9 108368023 intron probably benign
R4965:Usp4 UTSW 9 108362620 missense probably damaging 1.00
R4981:Usp4 UTSW 9 108381418 missense probably benign 0.00
R5110:Usp4 UTSW 9 108362678 missense probably damaging 1.00
R5580:Usp4 UTSW 9 108365859 missense probably benign 0.09
R5586:Usp4 UTSW 9 108356462 missense possibly damaging 0.95
R5927:Usp4 UTSW 9 108391760 missense probably benign 0.09
R6025:Usp4 UTSW 9 108360123 missense possibly damaging 0.70
R6112:Usp4 UTSW 9 108356504 missense probably damaging 1.00
R6197:Usp4 UTSW 9 108370955 missense probably damaging 1.00
R6742:Usp4 UTSW 9 108374239 missense possibly damaging 0.74
R7320:Usp4 UTSW 9 108388306 missense probably benign 0.00
R7458:Usp4 UTSW 9 108367856 missense probably damaging 1.00
R7531:Usp4 UTSW 9 108372680 missense probably damaging 1.00
R7563:Usp4 UTSW 9 108379344 missense probably benign
X0026:Usp4 UTSW 9 108347870 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTGCTGAAAGCCGCATGGAAC -3'
(R):5'- GACTACTGTGAATCCGAATGGACCG -3'

Sequencing Primer
(F):5'- CTGCACGGATTTAGCATCAG -3'
(R):5'- AATGGACCGGGACAAACC -3'
Posted On2013-07-11