Incidental Mutation 'R1356:Krt9'
ID156329
Institutional Source Beutler Lab
Gene Symbol Krt9
Ensembl Gene ENSMUSG00000051617
Gene Namekeratin 9
SynonymsKrt1-9, K9
MMRRC Submission 039421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1356 (G1)
Quality Score159
Status Not validated
Chromosome11
Chromosomal Location100186781-100193246 bp(-) (GRCm38)
Type of Mutationsmall insertion (8 aa in frame mutation)
DNA Base Change (assembly) CTGC to CTGCNNNNNNNNNNNNNNNNNNNNNTGC at 100188814 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059707]
Predicted Effect probably benign
Transcript: ENSMUST00000059707
SMART Domains Protein: ENSMUSP00000055255
Gene: ENSMUSG00000051617

DomainStartEndE-ValueType
low complexity region 6 125 N/A INTRINSIC
Filament 130 442 2.96e-124 SMART
low complexity region 462 716 N/A INTRINSIC
low complexity region 721 737 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperpigmented calluses on the footpad with acanthosis, hyperkeratosis, thick epidermis and increased keratinocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,302,953 probably benign Het
Adam18 A G 8: 24,668,595 probably benign Het
Cd274 C A 19: 29,373,570 T22K possibly damaging Het
Cfap45 G A 1: 172,527,863 R26Q possibly damaging Het
Dvl3 AGCGGCGGCGGCGG AGCGGCGGCGG 16: 20,524,305 probably benign Het
E2f8 A G 7: 48,880,270 probably benign Het
Ercc4 A G 16: 13,125,282 H255R probably damaging Het
Fam227b C T 2: 126,119,008 D234N probably damaging Het
Foxp1 A T 6: 99,016,676 probably benign Het
Fsip2 T A 2: 82,989,745 V5274D probably benign Het
Gm21718 A G 14: 51,316,647 noncoding transcript Het
Gpr85 G A 6: 13,836,147 P253S probably benign Het
Grm7 A T 6: 111,359,024 I799F probably damaging Het
Inpp1 A G 1: 52,797,056 F84L possibly damaging Het
Kprp T A 3: 92,825,602 E47V probably damaging Het
Lama3 G A 18: 12,500,577 probably benign Het
Lurap1l C G 4: 80,911,530 A59G probably benign Het
Macc1 A T 12: 119,446,555 T353S probably benign Het
Mctp2 A G 7: 72,164,723 probably benign Het
Mdn1 T C 4: 32,700,334 probably benign Het
Mpeg1 T A 19: 12,461,325 V49D probably damaging Het
Nos2 C T 11: 78,952,803 P859S probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Parn A T 16: 13,650,674 Y214* probably null Het
Pibf1 A G 14: 99,137,196 E357G possibly damaging Het
Prex2 C T 1: 11,080,092 Q163* probably null Het
Prune2 T A 19: 17,212,317 S294T probably benign Het
Slc46a1 A G 11: 78,470,724 N399D probably benign Het
Sstr2 T C 11: 113,624,894 F213S probably damaging Het
Tnxb A G 17: 34,695,472 E1967G possibly damaging Het
Vmn2r59 A G 7: 42,011,794 *866Q probably null Het
Other mutations in Krt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Krt9 APN 11 100190006 missense probably damaging 1.00
IGL01695:Krt9 APN 11 100191437 critical splice donor site probably null
IGL02383:Krt9 APN 11 100191215 missense probably damaging 1.00
IGL02529:Krt9 APN 11 100189966 missense probably damaging 0.99
IGL02819:Krt9 APN 11 100191520 missense probably damaging 1.00
droplet UTSW 11 100190788 missense probably damaging 1.00
G1citation:Krt9 UTSW 11 100189077 small deletion probably benign
R1397:Krt9 UTSW 11 100192638 missense probably damaging 1.00
R1498:Krt9 UTSW 11 100188369 nonsense probably null
R1772:Krt9 UTSW 11 100191305 missense probably damaging 0.99
R1871:Krt9 UTSW 11 100190788 missense probably damaging 1.00
R1883:Krt9 UTSW 11 100188697 missense unknown
R1985:Krt9 UTSW 11 100189991 missense probably benign 0.02
R2056:Krt9 UTSW 11 100191495 missense probably damaging 1.00
R2253:Krt9 UTSW 11 100190859 missense possibly damaging 0.83
R2305:Krt9 UTSW 11 100193116 missense unknown
R2875:Krt9 UTSW 11 100189205 nonsense probably null
R3813:Krt9 UTSW 11 100189677 missense probably damaging 1.00
R3874:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4157:Krt9 UTSW 11 100188649 missense unknown
R4762:Krt9 UTSW 11 100190849 missense probably damaging 1.00
R4873:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4875:Krt9 UTSW 11 100190037 missense probably benign 0.06
R4923:Krt9 UTSW 11 100189077 small deletion probably benign
R4973:Krt9 UTSW 11 100188712 missense unknown
R5153:Krt9 UTSW 11 100191242 missense probably damaging 0.99
R5658:Krt9 UTSW 11 100190767 missense probably damaging 0.98
R5696:Krt9 UTSW 11 100189077 small deletion probably benign
R5944:Krt9 UTSW 11 100188439 missense unknown
R6147:Krt9 UTSW 11 100188839 missense unknown
R6403:Krt9 UTSW 11 100189659 missense probably damaging 0.99
R6476:Krt9 UTSW 11 100190814 missense probably damaging 1.00
R6822:Krt9 UTSW 11 100189077 small deletion probably benign
R7159:Krt9 UTSW 11 100189077 small deletion probably benign
R7174:Krt9 UTSW 11 100189077 small deletion probably benign
R7203:Krt9 UTSW 11 100190791 missense probably damaging 1.00
R7805:Krt9 UTSW 11 100192696 missense possibly damaging 0.85
R7817:Krt9 UTSW 11 100189077 small deletion probably benign
R7822:Krt9 UTSW 11 100189077 small deletion probably benign
R7834:Krt9 UTSW 11 100192666 missense probably benign 0.06
R7947:Krt9 UTSW 11 100189077 small deletion probably benign
R7977:Krt9 UTSW 11 100189077 small deletion probably benign
R8943:Krt9 UTSW 11 100189077 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCCAGAACTGCTTCCTCCTCCATAG -3'
(R):5'- GTGAATCGTCTGGAGCTGGACAAA -3'

Sequencing Primer
(F):5'- gctacctccactttttccacc -3'
(R):5'- tggaggaggaagtggagg -3'
Posted On2014-02-11