Incidental Mutation 'R1424:Acad12'
ID161216
Institutional Source Beutler Lab
Gene Symbol Acad12
Ensembl Gene ENSMUSG00000042647
Gene Nameacyl-Coenzyme A dehydrogenase family, member 12
Synonyms9330129D05Rik
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R1424 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121596775-121618938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121604322 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 408 (A408T)
Ref Sequence ENSEMBL: ENSMUSP00000046497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041252] [ENSMUST00000111776] [ENSMUST00000197916]
Predicted Effect probably benign
Transcript: ENSMUST00000041252
AA Change: A408T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000046497
Gene: ENSMUSG00000042647
AA Change: A408T

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 151 278 7e-16 PFAM
Pfam:Acyl-CoA_dh_M 282 383 1.9e-18 PFAM
Pfam:Acyl-CoA_dh_1 395 536 1.5e-27 PFAM
Pfam:Acyl-CoA_dh_2 411 526 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111776
SMART Domains Protein: ENSMUSP00000107406
Gene: ENSMUSG00000042647

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 151 278 1.9e-15 PFAM
Pfam:Acyl-CoA_dh_M 282 336 1e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000131338
AA Change: A64T
SMART Domains Protein: ENSMUSP00000121904
Gene: ENSMUSG00000042647
AA Change: A64T

DomainStartEndE-ValueType
PDB:2WBI|B 2 92 2e-26 PDB
SCOP:d1is2a3 3 58 3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197916
SMART Domains Protein: ENSMUSP00000142370
Gene: ENSMUSG00000042647

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1j97a_ 40 67 1e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Acad12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Acad12 APN 5 121604253 unclassified probably benign
IGL02968:Acad12 APN 5 121610038 missense probably benign 0.17
IGL03046:Acad12 UTSW 5 121609966 missense probably benign 0.00
R0085:Acad12 UTSW 5 121604294 missense possibly damaging 0.85
R0538:Acad12 UTSW 5 121607448 missense possibly damaging 0.85
R1754:Acad12 UTSW 5 121607481 missense probably benign 0.08
R1975:Acad12 UTSW 5 121604259 missense probably benign
R3916:Acad12 UTSW 5 121599214 missense probably damaging 1.00
R3917:Acad12 UTSW 5 121599214 missense probably damaging 1.00
R4531:Acad12 UTSW 5 121598899 missense probably benign
R4531:Acad12 UTSW 5 121598901 missense probably benign
R4676:Acad12 UTSW 5 121607171 missense probably damaging 1.00
R5057:Acad12 UTSW 5 121610089 missense probably benign 0.00
R5166:Acad12 UTSW 5 121600020 missense probably benign 0.04
R5286:Acad12 UTSW 5 121604295 missense probably benign 0.27
R5641:Acad12 UTSW 5 121604021 unclassified probably benign
R5716:Acad12 UTSW 5 121609983 missense probably benign 0.00
R5761:Acad12 UTSW 5 121604180 unclassified probably benign
R6006:Acad12 UTSW 5 121599236 missense possibly damaging 0.46
R6256:Acad12 UTSW 5 121614086 missense probably benign 0.05
R6729:Acad12 UTSW 5 121607935 missense probably damaging 1.00
R6785:Acad12 UTSW 5 121609845 missense probably damaging 1.00
R7161:Acad12 UTSW 5 121607373 missense probably damaging 1.00
R7571:Acad12 UTSW 5 121607194 nonsense probably null
R8383:Acad12 UTSW 5 121607373 missense probably damaging 1.00
Z1177:Acad12 UTSW 5 121599194 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGCCACCATAAAACCTGCTCTTG -3'
(R):5'- GCTGTGACCCAGTTAGAAGCCTAAG -3'

Sequencing Primer
(F):5'- TGCAGATTCCAGGCATGGAC -3'
(R):5'- CTAAGGCCAGTGCCTGTAGATAG -3'
Posted On2014-03-14