Incidental Mutation 'R6256:Acad12'
ID506106
Institutional Source Beutler Lab
Gene Symbol Acad12
Ensembl Gene ENSMUSG00000042647
Gene Nameacyl-Coenzyme A dehydrogenase family, member 12
Synonyms9330129D05Rik
MMRRC Submission 044373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6256 (G1)
Quality Score210.009
Status Not validated
Chromosome5
Chromosomal Location121596775-121618938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121614086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 54 (V54E)
Ref Sequence ENSEMBL: ENSMUSP00000142370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041252] [ENSMUST00000111776] [ENSMUST00000197916]
Predicted Effect probably benign
Transcript: ENSMUST00000041252
AA Change: V54E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046497
Gene: ENSMUSG00000042647
AA Change: V54E

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 151 278 7e-16 PFAM
Pfam:Acyl-CoA_dh_M 282 383 1.9e-18 PFAM
Pfam:Acyl-CoA_dh_1 395 536 1.5e-27 PFAM
Pfam:Acyl-CoA_dh_2 411 526 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111776
AA Change: V54E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107406
Gene: ENSMUSG00000042647
AA Change: V54E

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 151 278 1.9e-15 PFAM
Pfam:Acyl-CoA_dh_M 282 336 1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197916
AA Change: V54E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000142370
Gene: ENSMUSG00000042647
AA Change: V54E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1j97a_ 40 67 1e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,428 Q361L probably damaging Het
Abca7 A G 10: 80,002,622 T577A probably damaging Het
Ago4 A G 4: 126,520,226 Y91H probably damaging Het
Akr1b10 T C 6: 34,387,688 V28A probably damaging Het
Ccdc33 T A 9: 58,101,918 probably null Het
Ccdc7a T C 8: 128,935,593 probably null Het
Ces1f A T 8: 93,265,794 V343E probably damaging Het
Cftr T C 6: 18,274,661 L896P probably damaging Het
Csmd3 G A 15: 47,669,729 P2375S probably damaging Het
Dnajb14 G C 3: 137,908,362 A345P probably damaging Het
Dnajb14 C T 3: 137,908,363 A345V probably damaging Het
Dnase1 G A 16: 4,037,621 R24K probably benign Het
Dnmbp C T 19: 43,852,281 V560M probably damaging Het
Dopey2 T A 16: 93,807,214 I1981N possibly damaging Het
Eif3a A C 19: 60,771,026 S770A possibly damaging Het
Fbxl7 A T 15: 26,553,002 C60S probably benign Het
Fras1 A T 5: 96,733,843 D2478V possibly damaging Het
Hrnr A G 3: 93,322,611 D52G probably damaging Het
Jmjd1c T A 10: 67,220,408 L823M probably damaging Het
Kdm1a G T 4: 136,568,600 C172* probably null Het
Kdm6b C T 11: 69,406,729 E295K probably damaging Het
Mepe A T 5: 104,337,074 M27L probably benign Het
Mogat2 A T 7: 99,219,895 H305Q probably damaging Het
Mst1r T A 9: 107,917,266 Y1215N probably damaging Het
Muc5ac A T 7: 141,789,795 H48L possibly damaging Het
Myo7b T C 18: 31,983,695 D953G probably damaging Het
Ocel1 T C 8: 71,371,828 probably benign Het
Pcdhb6 A G 18: 37,335,925 D633G probably damaging Het
Ppm1l A G 3: 69,497,897 I176V probably benign Het
Sall3 C T 18: 80,969,861 R1120H possibly damaging Het
Sbf1 G A 15: 89,300,867 P1018S probably benign Het
Setbp1 T C 18: 78,857,257 Y1065C probably damaging Het
Slc25a2 T C 18: 37,637,723 probably null Het
Slc4a2 C A 5: 24,435,890 T729K probably damaging Het
Sptlc2 T C 12: 87,355,531 E207G probably damaging Het
Sult6b1 A T 17: 78,906,914 F27I probably benign Het
Syf2 A T 4: 134,934,578 K84N probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmem232 G T 17: 65,478,402 Q188K possibly damaging Het
Tomm70a A T 16: 57,152,692 T598S probably benign Het
Ttll13 A G 7: 80,258,304 T556A probably benign Het
Vmn2r120 A T 17: 57,524,700 L363* probably null Het
Xpo6 G T 7: 126,108,619 Q872K probably damaging Het
Xrra1 A C 7: 99,914,464 S553R probably damaging Het
Zfy1 A T Y: 738,765 V147E unknown Homo
Zfy2 T C Y: 2,116,267 I258V probably benign Homo
Other mutations in Acad12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Acad12 APN 5 121604253 unclassified probably benign
IGL02968:Acad12 APN 5 121610038 missense probably benign 0.17
IGL03046:Acad12 UTSW 5 121609966 missense probably benign 0.00
R0085:Acad12 UTSW 5 121604294 missense possibly damaging 0.85
R0538:Acad12 UTSW 5 121607448 missense possibly damaging 0.85
R1424:Acad12 UTSW 5 121604322 missense probably benign 0.01
R1754:Acad12 UTSW 5 121607481 missense probably benign 0.08
R1975:Acad12 UTSW 5 121604259 missense probably benign
R3916:Acad12 UTSW 5 121599214 missense probably damaging 1.00
R3917:Acad12 UTSW 5 121599214 missense probably damaging 1.00
R4531:Acad12 UTSW 5 121598899 missense probably benign
R4531:Acad12 UTSW 5 121598901 missense probably benign
R4676:Acad12 UTSW 5 121607171 missense probably damaging 1.00
R5057:Acad12 UTSW 5 121610089 missense probably benign 0.00
R5166:Acad12 UTSW 5 121600020 missense probably benign 0.04
R5286:Acad12 UTSW 5 121604295 missense probably benign 0.27
R5641:Acad12 UTSW 5 121604021 unclassified probably benign
R5716:Acad12 UTSW 5 121609983 missense probably benign 0.00
R5761:Acad12 UTSW 5 121604180 unclassified probably benign
R6006:Acad12 UTSW 5 121599236 missense possibly damaging 0.46
R6729:Acad12 UTSW 5 121607935 missense probably damaging 1.00
R6785:Acad12 UTSW 5 121609845 missense probably damaging 1.00
R7161:Acad12 UTSW 5 121607373 missense probably damaging 1.00
R7571:Acad12 UTSW 5 121607194 nonsense probably null
R8383:Acad12 UTSW 5 121607373 missense probably damaging 1.00
R8473:Acad12 UTSW 5 121607475 missense probably damaging 1.00
Z1177:Acad12 UTSW 5 121599194 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTCAGACTCAGGTCGTAAC -3'
(R):5'- AGCCTCCATCTCACCATGTG -3'

Sequencing Primer
(F):5'- CGTAACAGTTTCATGTAGCTCAGGC -3'
(R):5'- GGGTAAGAAGACTTTTCCAGCCTTC -3'
Posted On2018-02-28