Incidental Mutation 'R1424:Cel'
ID161204
Institutional Source Beutler Lab
Gene Symbol Cel
Ensembl Gene ENSMUSG00000026818
Gene Namecarboxyl ester lipase
Synonyms1810036E18Rik, BAL
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1424 (G1)
Quality Score203
Status Validated
Chromosome2
Chromosomal Location28555795-28563403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28559624 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 243 (A243T)
Ref Sequence ENSEMBL: ENSMUSP00000028161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028161]
Predicted Effect probably damaging
Transcript: ENSMUST00000028161
AA Change: A243T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028161
Gene: ENSMUSG00000026818
AA Change: A243T

DomainStartEndE-ValueType
Pfam:COesterase 1 542 2.4e-163 PFAM
Pfam:Abhydrolase_3 121 226 8e-8 PFAM
low complexity region 568 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177012
Meta Mutation Damage Score 0.2655 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein secreted from the pancreas into the digestive tract and from the lactating mammary gland into human milk. The physiological role of this protein is in cholesterol and lipid-soluble vitamin ester hydrolysis and absorption. This encoded protein promotes large chylomicron production in the intestine. Also its presence in plasma suggests its interactions with cholesterol and oxidized lipoproteins to modulate the progression of atherosclerosis. In pancreatic tumoral cells, this encoded protein is thought to be sequestrated within the Golgi compartment and is probably not secreted. This gene contains a variable number of tandem repeat (VNTR) polymorphism in the coding region that may influence the function of the encoded protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced cholesteryl ester absorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Cel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Cel APN 2 28559385 missense probably damaging 0.98
IGL01327:Cel APN 2 28557955 missense possibly damaging 0.61
IGL01606:Cel APN 2 28560564 missense probably benign 0.04
R0304:Cel UTSW 2 28557771 missense probably benign 0.04
R0321:Cel UTSW 2 28561148 missense probably benign 0.00
R0865:Cel UTSW 2 28560615 missense probably damaging 1.00
R1123:Cel UTSW 2 28556740 missense probably damaging 1.00
R1448:Cel UTSW 2 28556326 missense probably damaging 1.00
R1597:Cel UTSW 2 28560467 splice site probably benign
R1717:Cel UTSW 2 28556777 missense probably damaging 1.00
R2256:Cel UTSW 2 28561192 missense probably damaging 1.00
R3149:Cel UTSW 2 28556131 missense probably benign 0.04
R4105:Cel UTSW 2 28558027 missense probably benign 0.35
R4520:Cel UTSW 2 28557968 missense probably benign 0.08
R5135:Cel UTSW 2 28559423 missense probably benign 0.39
R5318:Cel UTSW 2 28557708 missense possibly damaging 0.77
R5323:Cel UTSW 2 28560518 missense probably damaging 1.00
R5958:Cel UTSW 2 28560945 missense probably damaging 0.97
R6803:Cel UTSW 2 28558048 missense probably benign 0.36
R6976:Cel UTSW 2 28556842 missense probably damaging 1.00
R7342:Cel UTSW 2 28560637 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGCAGCCATCTTGCCAGTATC -3'
(R):5'- AGAGGAACATTGCAGCCTTTGGG -3'

Sequencing Primer
(F):5'- GTGGGGCATCCTACCTTCTTAG -3'
(R):5'- CTGATAACATCACCATCTTTGGG -3'
Posted On2014-03-14