Incidental Mutation 'R1442:Irf7'
ID161538
Institutional Source Beutler Lab
Gene Symbol Irf7
Ensembl Gene ENSMUSG00000025498
Gene Nameinterferon regulatory factor 7
Synonyms
MMRRC Submission 039497-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1442 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141262706-141266481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141264022 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 246 (T246A)
Ref Sequence ENSEMBL: ENSMUSP00000026571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026571] [ENSMUST00000097952] [ENSMUST00000106023] [ENSMUST00000106027] [ENSMUST00000122143] [ENSMUST00000155123] [ENSMUST00000209899]
PDB Structure
Crystal structure of IRF-7 DBD apo form [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000026571
AA Change: T246A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026571
Gene: ENSMUSG00000025498
AA Change: T246A

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 240 420 1.38e-63 SMART
low complexity region 425 442 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097952
AA Change: T215A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095565
Gene: ENSMUSG00000025498
AA Change: T215A

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 209 389 1.38e-63 SMART
low complexity region 394 411 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106023
AA Change: T214A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101644
Gene: ENSMUSG00000025498
AA Change: T214A

DomainStartEndE-ValueType
IRF 5 127 1.13e-54 SMART
IRF-3 208 388 1.38e-63 SMART
low complexity region 393 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106027
SMART Domains Protein: ENSMUSP00000101648
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
C1 173 229 7.05e-2 SMART
PHD 187 233 1.77e-14 SMART
RING 188 232 3.17e0 SMART
low complexity region 332 369 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 507 522 N/A INTRINSIC
low complexity region 717 728 N/A INTRINSIC
low complexity region 831 857 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 944 955 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 999 1020 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1051 1090 N/A INTRINSIC
low complexity region 1094 1151 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1217 1241 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1288 1306 N/A INTRINSIC
low complexity region 1308 1319 N/A INTRINSIC
low complexity region 1359 1376 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
low complexity region 1575 1592 N/A INTRINSIC
Blast:IG_like 1593 1636 4e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000122143
SMART Domains Protein: ENSMUSP00000113195
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
C1 14 70 7.05e-2 SMART
PHD 28 74 1.77e-14 SMART
low complexity region 173 210 N/A INTRINSIC
low complexity region 332 346 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
low complexity region 558 569 N/A INTRINSIC
low complexity region 672 698 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 840 861 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 892 931 N/A INTRINSIC
low complexity region 935 992 N/A INTRINSIC
low complexity region 1001 1014 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1086 1102 N/A INTRINSIC
low complexity region 1129 1147 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
low complexity region 1200 1217 N/A INTRINSIC
low complexity region 1267 1282 N/A INTRINSIC
low complexity region 1416 1433 N/A INTRINSIC
Blast:IG_like 1434 1477 4e-14 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000123525
AA Change: T82A
SMART Domains Protein: ENSMUSP00000121026
Gene: ENSMUSG00000025498
AA Change: T82A

DomainStartEndE-ValueType
IRF 1 69 6.35e-3 SMART
IRF-3 77 251 2.62e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127223
Predicted Effect probably benign
Transcript: ENSMUST00000130687
SMART Domains Protein: ENSMUSP00000123351
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 100 115 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
Blast:IG_like 242 285 5e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131399
Predicted Effect probably benign
Transcript: ENSMUST00000142572
SMART Domains Protein: ENSMUSP00000117393
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
low complexity region 75 96 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 127 166 N/A INTRINSIC
low complexity region 170 227 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
low complexity region 321 337 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 384 395 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 666 683 N/A INTRINSIC
Blast:IG_like 684 727 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148414
Predicted Effect probably benign
Transcript: ENSMUST00000155123
SMART Domains Protein: ENSMUSP00000120759
Gene: ENSMUSG00000038611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 39 70 N/A INTRINSIC
RING 109 149 3.78e-5 SMART
Blast:C1 165 209 2e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156938
Predicted Effect unknown
Transcript: ENSMUST00000209899
AA Change: D194G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210506
Meta Mutation Damage Score 0.8884 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRF7 encodes interferon regulatory factor 7, a member of the interferon regulatory transcription factor (IRF) family. IRF7 has been shown to play a role in the transcriptional activation of virus-inducible cellular genes, including interferon beta chain genes. Inducible expression of IRF7 is largely restricted to lymphoid tissue. Multiple IRF7 transcript variants have been identified, although the functional consequences of these have not yet been established. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are more vulnerable to viral infection and exhibit decreased serum interferon levels in response to viral infection. [provided by MGI curators]
Allele List at MGI

4 alleles

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,632 probably benign Het
Adamts7 T A 9: 90,188,770 I648N probably damaging Het
Akap13 T A 7: 75,735,778 F2252I probably damaging Het
Akr1c6 A T 13: 4,457,160 H314L probably damaging Het
Anxa3 T A 5: 96,828,690 probably null Het
Apob T G 12: 7,986,165 F298V probably benign Het
Atp8a2 A C 14: 59,860,323 probably benign Het
Atp8b5 A T 4: 43,334,313 T360S probably damaging Het
BC051665 A T 13: 60,784,741 N43K probably benign Het
Bicral T A 17: 46,801,724 H850L probably benign Het
C1qtnf1 A G 11: 118,448,185 D227G probably damaging Het
C8a T A 4: 104,828,078 T323S possibly damaging Het
Cep89 T C 7: 35,418,211 probably benign Het
Cercam G T 2: 29,880,640 V408L probably benign Het
CN725425 G A 15: 91,238,955 V76M possibly damaging Het
Cops7b T A 1: 86,605,113 M231K probably benign Het
Cpa2 T A 6: 30,544,866 probably null Het
Dab2ip A T 2: 35,710,256 I287F probably damaging Het
Defb10 A T 8: 21,858,928 M1L probably benign Het
Dscam C A 16: 96,608,074 R1883L possibly damaging Het
Dsg4 T A 18: 20,462,660 I640N possibly damaging Het
Duox2 G C 2: 122,281,751 P1318R probably benign Het
Dzip3 T C 16: 48,945,622 D466G probably benign Het
E230025N22Rik T A 18: 36,691,409 probably null Het
E2f3 A G 13: 29,918,669 L80P probably damaging Het
Eif2b2 T C 12: 85,219,586 S9P probably benign Het
Etaa1 A T 11: 17,947,201 D305E probably benign Het
Fads6 C A 11: 115,297,409 R23L probably benign Het
Flrt2 T C 12: 95,780,205 V439A probably damaging Het
Galm A C 17: 80,145,185 Q184P probably damaging Het
Gtse1 C T 15: 85,860,102 probably benign Het
Kif28 A G 1: 179,705,132 V639A possibly damaging Het
Klhdc8a G A 1: 132,302,647 A167T possibly damaging Het
Lrfn3 T C 7: 30,360,044 H252R probably benign Het
Lzts1 G T 8: 69,138,986 A170E probably damaging Het
Mphosph9 T A 5: 124,265,398 I856F possibly damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a C T 1: 88,232,353 probably benign Het
Myh3 A G 11: 67,087,277 N392D possibly damaging Het
Naalad2 T C 9: 18,351,032 probably benign Het
Npc1 T A 18: 12,195,049 M1068L probably benign Het
Nupl1 T A 14: 60,232,543 probably benign Het
Olfr1286 A T 2: 111,420,093 I286N probably damaging Het
Olfr285 T C 15: 98,313,187 Y121C probably damaging Het
Olfr906 A T 9: 38,488,643 I205F probably benign Het
Olfr95 T C 17: 37,211,704 T50A probably benign Het
Parp2 T G 14: 50,819,275 probably null Het
Ppp4r4 T C 12: 103,598,245 V9A probably damaging Het
Ptprc T A 1: 138,072,312 D856V probably damaging Het
Ptpru T A 4: 131,808,269 T466S probably benign Het
Rhob A G 12: 8,499,325 V103A possibly damaging Het
Sec23ip A C 7: 128,776,786 S775R probably benign Het
Slit2 T G 5: 48,238,383 D709E probably damaging Het
Smok2b C G 17: 13,235,503 I183M probably damaging Het
Smtnl1 T A 2: 84,818,436 D158V probably damaging Het
Syne2 T C 12: 75,946,715 I2087T probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tecta T A 9: 42,332,482 I2025F probably damaging Het
Themis T C 10: 28,782,135 V386A probably damaging Het
Ubr5 G A 15: 38,014,924 probably benign Het
Vcl T A 14: 20,983,378 I134N probably damaging Het
Vegfa G A 17: 46,025,492 T56I possibly damaging Het
Vmn2r108 T A 17: 20,472,361 K78* probably null Het
Vmn2r82 A T 10: 79,379,367 T395S probably benign Het
Wbp2nl T C 15: 82,314,206 S315P probably benign Het
Zfp566 T C 7: 30,077,919 Y279C probably damaging Het
Zmym2 T C 14: 56,943,327 Y899H probably damaging Het
Other mutations in Irf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Irf7 APN 7 141264640 missense probably benign 0.02
IGL03275:Irf7 APN 7 141265146 missense probably damaging 0.99
Houstonian UTSW 7 141264022 missense probably damaging 0.99
inept UTSW 7 141265140 missense probably damaging 1.00
R0593:Irf7 UTSW 7 141265062 unclassified probably benign
R1339:Irf7 UTSW 7 141263704 missense probably damaging 1.00
R4354:Irf7 UTSW 7 141265270 missense probably damaging 1.00
R4724:Irf7 UTSW 7 141264735 missense possibly damaging 0.92
R5444:Irf7 UTSW 7 141264819 unclassified probably benign
R5795:Irf7 UTSW 7 141265116 missense probably damaging 1.00
R7444:Irf7 UTSW 7 141263686 missense probably damaging 1.00
R7535:Irf7 UTSW 7 141264637 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAGCGTCTCTGTGTAGTGCAGC -3'
(R):5'- CAGGAGCAAGACCGTGTTTACGAG -3'

Sequencing Primer
(F):5'- GGGCTCTGAAGTTCTTACTGCT -3'
(R):5'- TGTTTACGAGGAACCCTATGCAG -3'
Posted On2014-03-14