Incidental Mutation 'R1618:Akp3'
ID174402
Institutional Source Beutler Lab
Gene Symbol Akp3
Ensembl Gene ENSMUSG00000036500
Gene Namealkaline phosphatase 3, intestine, not Mn requiring
SynonymsAkp-3, IAP
MMRRC Submission 039655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1618 (G1)
Quality Score85
Status Validated
Chromosome1
Chromosomal Location87124973-87127912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87127871 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 547 (G547R)
Ref Sequence ENSEMBL: ENSMUSP00000037497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044878]
Predicted Effect unknown
Transcript: ENSMUST00000044878
AA Change: G547R
SMART Domains Protein: ENSMUSP00000037497
Gene: ENSMUSG00000036500
AA Change: G547R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 53 487 1.92e-249 SMART
low complexity region 503 524 N/A INTRINSIC
low complexity region 533 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187662
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruption of this gene show no gross abnormalities in appearance, behavior or fertility. They do display accelerated lipid absorption on a high fat diet leading to elevated plasma triglycerides and increased weight gain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449E01Rik T C 14: 105,498,946 noncoding transcript Het
Abca8b A T 11: 109,949,888 probably benign Het
Anln A G 9: 22,350,918 probably null Het
Anpep T G 7: 79,835,417 Q607P probably benign Het
Arl13b A C 16: 62,813,277 probably null Het
Asxl3 T C 18: 22,516,987 S678P probably damaging Het
Atf6b C T 17: 34,647,728 Q58* probably null Het
Camsap3 A G 8: 3,598,740 T20A probably benign Het
Cfap46 T A 7: 139,652,810 M782L probably benign Het
Cngb3 T C 4: 19,364,260 S155P probably benign Het
Coro1a T C 7: 126,701,547 I162V probably benign Het
Cry1 T A 10: 85,146,454 I343F probably damaging Het
Csnk1e A T 15: 79,424,850 M292K probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cul9 A T 17: 46,525,892 M1069K probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dnah11 T C 12: 118,015,465 I2633V probably damaging Het
Eif4g3 C A 4: 138,206,058 D1731E probably damaging Het
Epb41l4b T C 4: 57,032,204 T592A probably benign Het
Evi5 T C 5: 107,799,118 probably benign Het
Exo1 T A 1: 175,901,386 M672K probably benign Het
Fcho1 T C 8: 71,710,403 S661G probably damaging Het
Fnip2 A G 3: 79,508,168 Y188H possibly damaging Het
Foxb1 T C 9: 69,760,011 D79G probably damaging Het
Fyco1 T C 9: 123,829,281 Y610C probably damaging Het
Gm3095 C A 14: 3,964,571 N96K probably damaging Het
Gm3095 T A 14: 3,964,572 Y97N probably damaging Het
Gmfb A T 14: 46,811,780 L128* probably null Het
Gprc5c T A 11: 114,864,394 V299D possibly damaging Het
Hsfy2 C T 1: 56,637,229 V50I probably benign Het
Hspa12b A C 2: 131,140,929 K236Q probably benign Het
Impg2 A G 16: 56,259,858 Y566C probably damaging Het
Itpr3 A C 17: 27,116,607 probably null Het
Kprp G A 3: 92,825,476 T89I probably damaging Het
Lcmt2 T C 2: 121,138,652 E650G probably damaging Het
Lrch1 T C 14: 74,813,704 D331G probably damaging Het
Mroh9 T A 1: 163,024,541 I860F probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myt1l A G 12: 29,827,397 D349G unknown Het
Ndufs2 T C 1: 171,246,121 T31A probably benign Het
Ndufs3 A T 2: 90,898,672 S157T probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Noct T A 3: 51,247,830 S6R probably damaging Het
Npas2 T A 1: 39,300,727 H119Q probably damaging Het
Olfr1076 T G 2: 86,508,849 L130R probably damaging Het
Olfr1206 A G 2: 88,865,527 probably null Het
Olfr138 G A 17: 38,275,666 probably null Het
Oprl1 A T 2: 181,718,853 Y207F probably benign Het
Palm3 G T 8: 84,029,662 S601I possibly damaging Het
Plscr1 T A 9: 92,266,495 C163S probably damaging Het
Ptprk A T 10: 28,493,170 M713L probably benign Het
Rdm1 A G 11: 101,628,391 D72G possibly damaging Het
Reln T C 5: 22,060,368 D442G probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sbno1 T C 5: 124,404,216 Y338C probably damaging Het
Seh1l T G 18: 67,788,736 V222G probably damaging Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Slc25a18 A C 6: 120,786,342 probably benign Het
Slc33a1 T C 3: 63,948,229 T332A possibly damaging Het
Slc35d3 A G 10: 19,849,163 S316P probably benign Het
Spata48 A G 11: 11,488,641 probably benign Het
Srrm2 T A 17: 23,818,932 probably benign Het
Srsf12 C T 4: 33,230,974 S156L probably damaging Het
Syce3 A G 15: 89,390,403 M49T probably benign Het
Tjp3 T C 10: 81,276,260 probably benign Het
Tnks G T 8: 34,875,276 N373K probably damaging Het
Togaram1 A G 12: 64,967,073 N366S possibly damaging Het
Trpm1 G A 7: 64,240,535 R962H probably damaging Het
Trpm6 A T 19: 18,877,631 M1885L possibly damaging Het
Tshz3 A G 7: 36,771,796 D1070G probably damaging Het
Ush2a T C 1: 188,814,224 M3399T probably benign Het
Utp15 G A 13: 98,257,187 T196I probably benign Het
Vmn1r168 T C 7: 23,541,300 I194T probably benign Het
Vmn2r73 C T 7: 85,875,912 W9* probably null Het
Wdr17 T C 8: 54,639,895 Y1076C probably damaging Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zbtb46 A T 2: 181,424,249 V36E possibly damaging Het
Zfp558 T C 9: 18,469,283 I9M possibly damaging Het
Zscan2 T A 7: 80,875,786 Y418* probably null Het
Other mutations in Akp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Akp3 APN 1 87127136 splice site probably benign
IGL02146:Akp3 APN 1 87126575 missense probably benign 0.00
IGL02216:Akp3 APN 1 87127650 missense probably damaging 1.00
IGL02677:Akp3 APN 1 87125272 missense probably damaging 1.00
IGL02716:Akp3 APN 1 87125479 missense probably damaging 1.00
IGL02943:Akp3 APN 1 87126369 nonsense probably null
IGL03099:Akp3 APN 1 87127606 missense probably benign 0.14
R0458:Akp3 UTSW 1 87126537 nonsense probably null
R0755:Akp3 UTSW 1 87127871 missense unknown
R0783:Akp3 UTSW 1 87127871 missense unknown
R0784:Akp3 UTSW 1 87127871 missense unknown
R1080:Akp3 UTSW 1 87127001 missense probably damaging 0.99
R1120:Akp3 UTSW 1 87125437 missense probably damaging 0.98
R1128:Akp3 UTSW 1 87127871 missense unknown
R1130:Akp3 UTSW 1 87127871 missense unknown
R1175:Akp3 UTSW 1 87127871 missense unknown
R1200:Akp3 UTSW 1 87125260 missense probably damaging 1.00
R1864:Akp3 UTSW 1 87127767 small deletion probably benign
R2111:Akp3 UTSW 1 87126885 intron probably null
R4657:Akp3 UTSW 1 87125834 intron probably benign
R5278:Akp3 UTSW 1 87125166 missense probably benign 0.01
R5563:Akp3 UTSW 1 87125924 missense probably damaging 1.00
R5643:Akp3 UTSW 1 87127763 missense unknown
R5768:Akp3 UTSW 1 87127122 missense probably damaging 0.99
R5809:Akp3 UTSW 1 87126548 missense probably benign 0.06
R5956:Akp3 UTSW 1 87126945 missense probably damaging 1.00
R5999:Akp3 UTSW 1 87127541 missense probably damaging 1.00
R6945:Akp3 UTSW 1 87125631 missense probably damaging 1.00
R7028:Akp3 UTSW 1 87126778 missense probably benign
R7154:Akp3 UTSW 1 87125224 missense probably damaging 0.99
R7162:Akp3 UTSW 1 87127749 missense unknown
R7486:Akp3 UTSW 1 87125479 missense probably damaging 1.00
X0018:Akp3 UTSW 1 87126338 missense probably damaging 1.00
X0060:Akp3 UTSW 1 87125894 missense probably damaging 1.00
X0066:Akp3 UTSW 1 87126796 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAGGAGCAGAACTACATCGC -3'
(R):5'- CTGCAATGCAAGGTAGGGCTAGAC -3'

Sequencing Primer
(F):5'- GAACTACATCGCGCACGTC -3'
(R):5'- CTAGACATGAGGCCAGTAGC -3'
Posted On2014-04-24