Mutagenetix > Incidental Mutation

Incidental Mutation 'R1618:Trpm1'

174430

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

039655-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1618 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64240535 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 962 (R962H)

Ref Sequence

ENSEMBL: ENSMUSP00000146226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]

AlphaFold

Q2TV84

Predicted Effect

probably damaging
Transcript: ENSMUST00000085222
AA Change: R962H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: R962H

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000107525
AA Change: R962H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: R962H

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
Pfam:Ion_trans	876	1138	7.6e-22	PFAM
transmembrane domain	1156	1173	N/A	INTRINSIC
Pfam:TRPM_tetra	1230	1285	9.4e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205466

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

probably damaging
Transcript: ENSMUST00000206263
AA Change: R846H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: R962H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206848

Meta Mutation Damage Score

0.6799

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.3%
20x: 89.1%

Validation Efficiency

96% (79/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449E01Rik	T	C	14: 105,498,946		noncoding transcript	Het
Abca8b	A	T	11: 109,949,888		probably benign	Het
Akp3	G	A	1: 87,127,871	G547R	unknown	Het
Anln	A	G	9: 22,350,918		probably null	Het
Anpep	T	G	7: 79,835,417	Q607P	probably benign	Het
Arl13b	A	C	16: 62,813,277		probably null	Het
Asxl3	T	C	18: 22,516,987	S678P	probably damaging	Het
Atf6b	C	T	17: 34,647,728	Q58*	probably null	Het
Camsap3	A	G	8: 3,598,740	T20A	probably benign	Het
Cfap46	T	A	7: 139,652,810	M782L	probably benign	Het
Cngb3	T	C	4: 19,364,260	S155P	probably benign	Het
Coro1a	T	C	7: 126,701,547	I162V	probably benign	Het
Cry1	T	A	10: 85,146,454	I343F	probably damaging	Het
Csnk1e	A	T	15: 79,424,850	M292K	probably benign	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Cul9	A	T	17: 46,525,892	M1069K	probably benign	Het
Cyp2c67	C	A	19: 39,643,264		probably benign	Het
Dnah11	T	C	12: 118,015,465	I2633V	probably damaging	Het
Eif4g3	C	A	4: 138,206,058	D1731E	probably damaging	Het
Epb41l4b	T	C	4: 57,032,204	T592A	probably benign	Het
Evi5	T	C	5: 107,799,118		probably benign	Het
Exo1	T	A	1: 175,901,386	M672K	probably benign	Het
Fcho1	T	C	8: 71,710,403	S661G	probably damaging	Het
Fnip2	A	G	3: 79,508,168	Y188H	possibly damaging	Het
Foxb1	T	C	9: 69,760,011	D79G	probably damaging	Het
Fyco1	T	C	9: 123,829,281	Y610C	probably damaging	Het
Gm3095	C	A	14: 3,964,571	N96K	probably damaging	Het
Gm3095	T	A	14: 3,964,572	Y97N	probably damaging	Het
Gmfb	A	T	14: 46,811,780	L128*	probably null	Het
Gprc5c	T	A	11: 114,864,394	V299D	possibly damaging	Het
Hsfy2	C	T	1: 56,637,229	V50I	probably benign	Het
Hspa12b	A	C	2: 131,140,929	K236Q	probably benign	Het
Impg2	A	G	16: 56,259,858	Y566C	probably damaging	Het
Itpr3	A	C	17: 27,116,607		probably null	Het
Kprp	G	A	3: 92,825,476	T89I	probably damaging	Het
Lcmt2	T	C	2: 121,138,652	E650G	probably damaging	Het
Lrch1	T	C	14: 74,813,704	D331G	probably damaging	Het
Mroh9	T	A	1: 163,024,541	I860F	probably benign	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Myt1l	A	G	12: 29,827,397	D349G	unknown	Het
Ndufs2	T	C	1: 171,246,121	T31A	probably benign	Het
Ndufs3	A	T	2: 90,898,672	S157T	probably benign	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Noct	T	A	3: 51,247,830	S6R	probably damaging	Het
Npas2	T	A	1: 39,300,727	H119Q	probably damaging	Het
Olfr1076	T	G	2: 86,508,849	L130R	probably damaging	Het
Olfr1206	A	G	2: 88,865,527		probably null	Het
Olfr138	G	A	17: 38,275,666		probably null	Het
Oprl1	A	T	2: 181,718,853	Y207F	probably benign	Het
Palm3	G	T	8: 84,029,662	S601I	possibly damaging	Het
Plscr1	T	A	9: 92,266,495	C163S	probably damaging	Het
Ptprk	A	T	10: 28,493,170	M713L	probably benign	Het
Rdm1	A	G	11: 101,628,391	D72G	possibly damaging	Het
Reln	T	C	5: 22,060,368	D442G	probably benign	Het
Rims4	C	T	2: 163,863,929	V262M	possibly damaging	Het
Sbno1	T	C	5: 124,404,216	Y338C	probably damaging	Het
Seh1l	T	G	18: 67,788,736	V222G	probably damaging	Het
Sept12	T	C	16: 4,996,476	K43R	probably damaging	Het
Slc25a18	A	C	6: 120,786,342		probably benign	Het
Slc33a1	T	C	3: 63,948,229	T332A	possibly damaging	Het
Slc35d3	A	G	10: 19,849,163	S316P	probably benign	Het
Spata48	A	G	11: 11,488,641		probably benign	Het
Srrm2	T	A	17: 23,818,932		probably benign	Het
Srsf12	C	T	4: 33,230,974	S156L	probably damaging	Het
Syce3	A	G	15: 89,390,403	M49T	probably benign	Het
Tjp3	T	C	10: 81,276,260		probably benign	Het
Tnks	G	T	8: 34,875,276	N373K	probably damaging	Het
Togaram1	A	G	12: 64,967,073	N366S	possibly damaging	Het
Trpm6	A	T	19: 18,877,631	M1885L	possibly damaging	Het
Tshz3	A	G	7: 36,771,796	D1070G	probably damaging	Het
Ush2a	T	C	1: 188,814,224	M3399T	probably benign	Het
Utp15	G	A	13: 98,257,187	T196I	probably benign	Het
Vmn1r168	T	C	7: 23,541,300	I194T	probably benign	Het
Vmn2r73	C	T	7: 85,875,912	W9*	probably null	Het
Wdr17	T	C	8: 54,639,895	Y1076C	probably damaging	Het
Zan	T	C	5: 137,383,830	T5152A	unknown	Het
Zbtb46	A	T	2: 181,424,249	V36E	possibly damaging	Het
Zfp558	T	C	9: 18,469,283	I9M	possibly damaging	Het
Zscan2	T	A	7: 80,875,786	Y418*	probably null	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GGCATTTCCTGCGTCTATGAAACCC -3'
(R):5'- ACACCCTAGCTTGGTTTGGTGCTC -3'

Sequencing Primer
(F):5'- CATGTGCAGAATTCAGTGCC -3'
(R):5'- GGTGCTCTAATGCCAAGTTATC -3'

Posted On

2014-04-24