Mutagenetix > Incidental Mutation

Incidental Mutation 'R6945:Akp3'

540820

Institutional Source

Beutler Lab

Gene Symbol

Akp3

Ensembl Gene

ENSMUSG00000036500

Gene Name

alkaline phosphatase 3, intestine, not Mn requiring

Synonyms

Akp-3, IAP

MMRRC Submission

045059-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.319) question?

Stock #

R6945 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87124973-87127912 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87125631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 102 (Y102C)

Ref Sequence

ENSEMBL: ENSMUSP00000037497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044878]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000044878
AA Change: Y102C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037497
Gene: ENSMUSG00000036500
AA Change: Y102C

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	33	45	N/A	INTRINSIC
alkPPc	53	487	1.92e-249	SMART
low complexity region	503	524	N/A	INTRINSIC
low complexity region	533	557	N/A	INTRINSIC

Meta Mutation Damage Score

0.9615

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

96% (51/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruption of this gene show no gross abnormalities in appearance, behavior or fertility. They do display accelerated lipid absorption on a high fat diet leading to elevated plasma triglycerides and increased weight gain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	A	C	5: 109,676,845	N246K	probably benign	Het
AA792892	C	T	5: 94,383,631	H125Y	possibly damaging	Het
Abcc5	T	A	16: 20,400,009	T208S	probably benign	Het
Acaa2	A	G	18: 74,793,309	E112G	probably benign	Het
Adgrb1	A	G	15: 74,550,024	N881S	probably damaging	Het
Adgre1	A	G	17: 57,410,844	E314G	probably benign	Het
Adgre1	A	G	17: 57,420,399	E443G	probably benign	Het
Birc6	A	G	17: 74,579,531	N618S	probably benign	Het
Bpifc	A	G	10: 85,979,214	V296A	probably benign	Het
Cacna2d3	G	A	14: 28,969,318		probably benign	Het
Cacnb4	T	C	2: 52,474,954	N99S	probably damaging	Het
Cd38	A	G	5: 43,908,006	Y283C	probably damaging	Het
Celf4	T	A	18: 25,496,236	Q411L	probably damaging	Het
Cemip	A	T	7: 83,998,547	H108Q	probably damaging	Het
Col23a1	A	G	11: 51,561,893	E225G	unknown	Het
Dnah11	T	C	12: 118,060,310	E1902G	probably damaging	Het
Dst	A	G	1: 34,190,490	D2063G	probably damaging	Het
Fsip2	A	T	2: 82,992,840	I6306L	probably benign	Het
Furin	A	G	7: 80,391,090	S667P	possibly damaging	Het
Glmp	T	A	3: 88,325,832	S92R	probably benign	Het
Gm11563	C	G	11: 99,658,472	C152S	unknown	Het
Gm3486	A	G	14: 41,484,561	V185A	probably benign	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Hyal1	C	A	9: 107,579,170	A102E	probably damaging	Het
Invs	T	C	4: 48,421,785	C806R	probably benign	Het
L1td1	T	C	4: 98,733,696	V165A	probably benign	Het
Lama1	A	G	17: 67,813,866	T2666A		Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrrc8a	A	G	2: 30,256,227	Y351C	probably damaging	Het
Myh7b	T	C	2: 155,622,232	F551S	possibly damaging	Het
Myo19	A	G	11: 84,897,560	T333A	probably benign	Het
Nrp2	A	T	1: 62,760,788	N387I	probably damaging	Het
Oas2	T	C	5: 120,736,139	D543G	probably benign	Het
Olfr1040	A	G	2: 86,146,084	S217P	probably damaging	Het
Olfr117	A	G	17: 37,659,514	I273T	possibly damaging	Het
Pak7	A	G	2: 136,100,939	V427A	probably benign	Het
Pfas	G	A	11: 69,000,530	A247V	probably benign	Het
Psat1	T	A	19: 15,917,181	T115S	probably benign	Het
Psme4	T	A	11: 30,837,437	D1077E	probably benign	Het
Rabgap1l	A	G	1: 160,682,182	S442P	probably benign	Het
Ralgapa1	A	G	12: 55,776,191	M280T	possibly damaging	Het
Rb1cc1	A	T	1: 6,261,032	E394D	probably damaging	Het
Seh1l	T	C	18: 67,789,390	V271A	probably benign	Het
Sf3b1	A	T	1: 54,997,156	N919K	probably benign	Het
Sftpd	A	G	14: 41,174,492	S245P	possibly damaging	Het
Slc22a15	T	C	3: 101,924,114	E2G	probably damaging	Het
Spta1	A	G	1: 174,209,325	D1134G	possibly damaging	Het
Syna	A	G	5: 134,558,961	V378A	probably damaging	Het
Tchp	A	G	5: 114,709,350	K77E	possibly damaging	Het
Tescl	T	C	7: 24,333,531	N123S	probably benign	Het
Trio	C	T	15: 27,824,090	R1443Q	probably damaging	Het
Trrap	A	T	5: 144,790,855	Y462F	possibly damaging	Het
Vmn1r78	A	G	7: 12,152,905	T148A	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het

Other mutations in Akp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Akp3	APN	1	87127136	splice site	probably benign
IGL02146:Akp3	APN	1	87126575	missense	probably benign	0.00
IGL02216:Akp3	APN	1	87127650	missense	probably damaging	1.00
IGL02677:Akp3	APN	1	87125272	missense	probably damaging	1.00
IGL02716:Akp3	APN	1	87125479	missense	probably damaging	1.00
IGL02943:Akp3	APN	1	87126369	nonsense	probably null
IGL03099:Akp3	APN	1	87127606	missense	probably benign	0.14
R0458:Akp3	UTSW	1	87126537	nonsense	probably null
R0755:Akp3	UTSW	1	87127871	missense	unknown
R0783:Akp3	UTSW	1	87127871	missense	unknown
R0784:Akp3	UTSW	1	87127871	missense	unknown
R1080:Akp3	UTSW	1	87127001	missense	probably damaging	0.99
R1120:Akp3	UTSW	1	87125437	missense	probably damaging	0.98
R1128:Akp3	UTSW	1	87127871	missense	unknown
R1130:Akp3	UTSW	1	87127871	missense	unknown
R1175:Akp3	UTSW	1	87127871	missense	unknown
R1200:Akp3	UTSW	1	87125260	missense	probably damaging	1.00
R1618:Akp3	UTSW	1	87127871	missense	unknown
R1864:Akp3	UTSW	1	87127767	small deletion	probably benign
R2111:Akp3	UTSW	1	87126885	splice site	probably null
R4657:Akp3	UTSW	1	87125834	intron	probably benign
R5278:Akp3	UTSW	1	87125166	missense	probably benign	0.01
R5563:Akp3	UTSW	1	87125924	missense	probably damaging	1.00
R5643:Akp3	UTSW	1	87127763	missense	unknown
R5768:Akp3	UTSW	1	87127122	missense	probably damaging	0.99
R5809:Akp3	UTSW	1	87126548	missense	probably benign	0.06
R5956:Akp3	UTSW	1	87126945	missense	probably damaging	1.00
R5999:Akp3	UTSW	1	87127541	missense	probably damaging	1.00
R7028:Akp3	UTSW	1	87126778	missense	probably benign
R7154:Akp3	UTSW	1	87125224	missense	probably damaging	0.99
R7162:Akp3	UTSW	1	87127749	missense	unknown
R7486:Akp3	UTSW	1	87125479	missense	probably damaging	1.00
R7825:Akp3	UTSW	1	87127767	small deletion	probably benign
R8267:Akp3	UTSW	1	87127739	missense	unknown
R8708:Akp3	UTSW	1	87126369	nonsense	probably null
R9026:Akp3	UTSW	1	87127064	missense	possibly damaging	0.89
R9433:Akp3	UTSW	1	87125795	missense	probably benign	0.01
X0018:Akp3	UTSW	1	87126338	missense	probably damaging	1.00
X0060:Akp3	UTSW	1	87125894	missense	probably damaging	1.00
X0066:Akp3	UTSW	1	87126796	missense	probably damaging	0.98
Z1177:Akp3	UTSW	1	87126445	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTCATCTAGGACCTGAGACACC -3'
(R):5'- AAGGTCAGGGTGAGACATCC -3'

Sequencing Primer
(F):5'- TGAGACACCCCTAGCCATGG -3'
(R):5'- GACATCCAGTCCCCTAGGCTTG -3'

Posted On

2018-11-28